\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117720606:

Variant ID: vg1117720606 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17720606
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCATTCGAAGATTAATTCTTTGGAAAATCACAAAAGCCCACCCCATAGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTTTAGGAGAGGG[G/A]
GACCTCCTTAAAAGGGAGTATGCCCTCCTAGCTACTTGAAGCATGTGTGGTGGAGAGAAGAGGGGGAACACTCGCTCGCCTCGCCTGGCAGGGCAGGGCA

Reverse complement sequence

TGCCCTGCCCTGCCAGGCGAGGCGAGCGAGTGTTCCCCCTCTTCTCTCCACCACACATGCTTCAAGTAGCTAGGAGGGCATACTCCCTTTTAAGGAGGTC[C/T]
CCCTCTCCTAAAATAAGCAAGGTGGTACTAAACTCCACATGCATGCCATCCTATGGGGTGGGCTTTTGTGATTTTCCAAAGAATTAATCTTCGAATGGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 34.40% 1.31% 0.00% NA
All Indica  2759 85.20% 14.30% 0.47% 0.00% NA
All Japonica  1512 27.30% 72.40% 0.26% 0.00% NA
Aus  269 79.90% 19.70% 0.37% 0.00% NA
Indica I  595 79.30% 20.70% 0.00% 0.00% NA
Indica II  465 75.90% 22.60% 1.51% 0.00% NA
Indica III  913 94.20% 5.80% 0.00% 0.00% NA
Indica Intermediate  786 84.90% 14.40% 0.76% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 70.20% 29.20% 0.60% 0.00% NA
Japonica Intermediate  241 17.00% 82.60% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 50.00% 39.58% 0.00% NA
Intermediate  90 53.30% 40.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117720606 G -> A LOC_Os11g30484.1 upstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:37.256; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1117720606 G -> A LOC_Os11g30470.1 downstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:37.256; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1117720606 G -> A LOC_Os11g30470-LOC_Os11g30484 intergenic_region ; MODIFIER silent_mutation Average:37.256; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117720606 NA 3.84E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 2.49E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 5.24E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 3.58E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.51E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.29E-26 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.34E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.09E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 6.00E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 2.30E-07 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.19E-09 mr1359_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 7.33E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 2.40E-24 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 9.16E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 2.34E-11 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.38E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 1.94E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 3.26E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720606 NA 4.11E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251