\
| Variant ID: vg1117719367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17719367 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
TCATTGGCTCGCTGATTTACCTGGCTAGTGCAACTAGGCCTGATATCTCCTTTGCTGTCAGCATGGTGAGCCGGTTTACCTCTAATCCGGGAGATGATCA[C/T]
TGGCGTGCGCTTGAGCGAGTAATGCGCTATCTGAAAGGTACTATGGAATTAGGGCTTCACTATTCTGGGTATCCTGCGGTACTGGAGGGATATAGTGATT
AATCACTATATCCCTCCAGTACCGCAGGATACCCAGAATAGTGAAGCCCTAATTCCATAGTACCTTTCAGATAGCGCATTACTCGCTCAAGCGCACGCCA[G/A]
TGATCATCTCCCGGATTAGAGGTAAACCGGCTCACCATGCTGACAGCAAAGGAGATATCAGGCCTAGTTGCACTAGCCAGGTAAATCAGCGAGCCAATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 9.60% | 14.64% | 1.08% | NA |
| All Indica | 2759 | 69.30% | 4.30% | 24.54% | 1.81% | NA |
| All Japonica | 1512 | 78.20% | 21.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.10% | 3.00% | 42.86% | 4.03% | NA |
| Indica II | 465 | 81.70% | 1.50% | 16.34% | 0.43% | NA |
| Indica III | 913 | 73.40% | 6.20% | 18.73% | 1.64% | NA |
| Indica Intermediate | 786 | 71.90% | 4.70% | 22.26% | 1.15% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 57.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 11.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 11.10% | 12.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117719367 | C -> T | LOC_Os11g30470.1 | synonymous_variant ; p.His981His; LOW | synonymous_codon | Average:36.715; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1117719367 | C -> DEL | LOC_Os11g30470.1 | N | frameshift_variant | Average:36.715; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117719367 | 9.86E-06 | NA | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | 6.33E-06 | NA | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 1.61E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 6.84E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 8.95E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 7.63E-08 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 2.52E-07 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 1.52E-07 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 9.81E-06 | mr1440_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | 4.33E-06 | 6.37E-08 | mr1467_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 3.83E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 9.05E-06 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 3.35E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 2.01E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | 8.55E-06 | NA | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 7.16E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 4.18E-06 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 3.49E-06 | mr1811_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 4.35E-06 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117719367 | NA | 8.97E-06 | mr1816_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |