\
| Variant ID: vg1117649044 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 17649044 |
| Reference Allele: C | Alternative Allele: T,CCGGAACT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 111. )
AGTCTTAAGGATTATATATTGTATAAAAGATCTAAATAATCTTTACTCACTAAAGTAGTGATCTTTAGTCCCGGTTGGTGGCCCCGTGACAGGCCACTGA[C/T,CCGGAACT]
AGGGGATGAACCGGAACTAAAGATAACACCAATCGGGACTAAAGATCACATAGCTTTTAACAGGCTTTTTTTTCCTGGTTCTTATTAAAACCGGACTATT
AATAGTCCGGTTTTAATAAGAACCAGGAAAAAAAAGCCTGTTAAAAGCTATGTGATCTTTAGTCCCGATTGGTGTTATCTTTAGTTCCGGTTCATCCCCT[G/A,AGTTCCGG]
TCAGTGGCCTGTCACGGGGCCACCAACCGGGACTAAAGATCACTACTTTAGTGAGTAAAGATTATTTAGATCTTTTATACAATATATAATCCTTAAGACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 40.90% | 0.40% | 0.00% | CCGGAACT: 0.44% |
| All Indica | 2759 | 43.70% | 55.00% | 0.65% | 0.00% | CCGGAACT: 0.62% |
| All Japonica | 1512 | 90.70% | 9.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 10.00% | 88.80% | 0.00% | 0.00% | CCGGAACT: 1.12% |
| Indica I | 595 | 35.00% | 64.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 47.10% | 52.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 48.70% | 49.90% | 0.44% | 0.00% | CCGGAACT: 0.88% |
| Indica Intermediate | 786 | 42.50% | 55.30% | 1.02% | 0.00% | CCGGAACT: 1.15% |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 5.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 0.00% | 0.00% | CCGGAACT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117649044 | C -> T | LOC_Os11g30370-LOC_Os11g30390 | intergenic_region ; MODIFIER | silent_mutation | Average:63.786; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
| vg1117649044 | C -> CCGGAACT | LOC_Os11g30370-LOC_Os11g30390 | intergenic_region ; MODIFIER | silent_mutation | Average:63.786; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117649044 | NA | 4.16E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 1.15E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 4.65E-08 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 2.70E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 3.15E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 3.45E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 2.61E-06 | mr1800 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | 3.99E-06 | NA | mr1826 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117649044 | NA | 4.94E-08 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |