Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1117624559:

Variant ID: vg1117624559 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17624559
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTGGCTGTATAGATAAAATAATATTTACATTGTAATATAAAACTACAGTCCTATATAACTAAAATTACATTTGTAAATTCAGTTAATATAACATATAA[G/A,T]
TGCACTATAATTTTGATAAAAATAATCTGTAAGTAAATATGTATTTATTATTTTCTTTTGTAGTCCGTTGGATGTAAATGTAATGGTAGAAAAAATCTGA

Reverse complement sequence

TCAGATTTTTTCTACCATTACATTTACATCCAACGGACTACAAAAGAAAATAATAAATACATATTTACTTACAGATTATTTTTATCAAAATTATAGTGCA[C/T,A]
TTATATGTTATATTAACTGAATTTACAAATGTAATTTTAGTTATATAGGACTGTAGTTTTATATTACAATGTAAATATTATTTTATCTATACAGCCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	5.20%	0.17%	0.00%	T: 0.08%
All Indica	2759	99.50%	0.00%	0.29%	0.00%	T: 0.14%
All Japonica	1512	84.10%	15.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.80%	0.00%	1.51%	0.00%	T: 0.65%
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.13%	0.00%	T: 0.13%
Temperate Japonica	767	69.40%	30.60%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117624559	G -> T	LOC_Os11g30360.1	upstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:41.674; most accessible tissue: Zhenshan97 flower, score: 61.362	N	N	N	N
vg1117624559	G -> T	LOC_Os11g30350-LOC_Os11g30360	intergenic_region ; MODIFIER	silent_mutation	Average:41.674; most accessible tissue: Zhenshan97 flower, score: 61.362	N	N	N	N
vg1117624559	G -> A	LOC_Os11g30360.1	upstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:41.674; most accessible tissue: Zhenshan97 flower, score: 61.362	N	N	N	N
vg1117624559	G -> A	LOC_Os11g30350-LOC_Os11g30360	intergenic_region ; MODIFIER	silent_mutation	Average:41.674; most accessible tissue: Zhenshan97 flower, score: 61.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117624559	NA	3.38E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117624559	NA	1.74E-07	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	1.79E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	1.80E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	2.08E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	1.02E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	7.25E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	1.06E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	5.18E-08	NA	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	1.50E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	2.06E-06	2.70E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117624559	NA	4.59E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251