RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1117619488:

Variant ID: vg1117619488 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17619488
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCCACCGCCAGCGTCTCCGACGGCACGAACACCGGGTGCCGGGTCATCACCTTCCACGCCGGCGTCTCCTCGATCTTCAGCTCCCGCGCGATCACCCG[C/T]
GTCGCAATGTCCTGCAGATTGATCGATTGATTGATTGATTGTTCGTATCTTTTACATACAGAGAAGGGGAAATTAAGCGTATATATTCATGTTGCCACAT

Reverse complement sequence

ATGTGGCAACATGAATATATACGCTTAATTTCCCCTTCTCTGTATGTAAAAGATACGAACAATCAATCAATCAATCGATCAATCTGCAGGACATTGCGAC[G/A]
CGGGTGATCGCGCGGGAGCTGAAGATCGAGGAGACGCCGGCGTGGAAGGTGATGACCCGGCACCCGGTGTTCGTGCCGTCGGAGACGCTGGCGGTGGAGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.50%	0.40%	0.00%	NA
All Indica	2759	71.90%	27.50%	0.62%	0.00%	NA
All Japonica	1512	91.10%	8.90%	0.00%	0.00%	NA
Aus	269	13.80%	85.50%	0.74%	0.00%	NA
Indica I	595	91.80%	6.70%	1.51%	0.00%	NA
Indica II	465	77.60%	22.40%	0.00%	0.00%	NA
Indica III	913	60.70%	39.10%	0.22%	0.00%	NA
Indica Intermediate	786	66.40%	32.80%	0.76%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	78.80%	21.20%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	75.00%	25.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117619488	C -> T	LOC_Os11g30350.1	upstream_gene_variant ; 1452.0bp to feature; MODIFIER	silent_mutation	Average:69.463; most accessible tissue: Minghui63 root, score: 83.399	N	N	N	N
vg1117619488	C -> T	LOC_Os11g30340.1	downstream_gene_variant ; 4150.0bp to feature; MODIFIER	silent_mutation	Average:69.463; most accessible tissue: Minghui63 root, score: 83.399	N	N	N	N
vg1117619488	C -> T	LOC_Os11g30350-LOC_Os11g30360	intergenic_region ; MODIFIER	silent_mutation	Average:69.463; most accessible tissue: Minghui63 root, score: 83.399	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117619488	NA	6.58E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117619488	NA	3.17E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117619488	4.78E-06	4.77E-06	mr1187_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1117619488:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact