Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117614573:

Variant ID: vg1117614573 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17614573
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAAAAGGGGAAGGGCCAAAACGTTTACTGTTCACATACAACTTAAAAGGTTGTTATGCCAAATCCACACTGTTCCATCTCCTCGATCTGCAAGAAGTG[T/G]
TGTTCCCCTAATTTCATCATAGGTTAATTGGATCCATGCTACTACAAATATACCAAATTTAAAAAATACCACTACTATTTACGATATCGACTGGGTGCCA

Reverse complement sequence

TGGCACCCAGTCGATATCGTAAATAGTAGTGGTATTTTTTAAATTTGGTATATTTGTAGTAGCATGGATCCAATTAACCTATGATGAAATTAGGGGAACA[A/C]
CACTTCTTGCAGATCGAGGAGATGGAACAGTGTGGATTTGGCATAACAACCTTTTAAGTTGTATGTGAACAGTAAACGTTTTGGCCCTTCCCCTTTTTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	32.50%	1.18%	19.53%	NA
All Indica	2759	71.70%	7.10%	1.45%	19.75%	NA
All Japonica	1512	10.30%	81.90%	0.46%	7.34%	NA
Aus	269	5.20%	8.90%	1.86%	84.01%	NA
Indica I	595	85.50%	10.10%	0.34%	4.03%	NA
Indica II	465	68.20%	1.50%	1.29%	29.03%	NA
Indica III	913	64.30%	8.80%	1.64%	25.30%	NA
Indica Intermediate	786	71.80%	6.40%	2.16%	19.72%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	21.20%	57.10%	1.39%	20.24%	NA
Japonica Intermediate	241	11.60%	84.60%	0.00%	3.73%	NA
VI/Aromatic	96	25.00%	47.90%	1.04%	26.04%	NA
Intermediate	90	44.40%	34.40%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117614573	T -> DEL	N	N	silent_mutation	Average:46.836; most accessible tissue: Callus, score: 85.782	N	N	N	N
vg1117614573	T -> G	LOC_Os11g30340.1	upstream_gene_variant ; 243.0bp to feature; MODIFIER	silent_mutation	Average:46.836; most accessible tissue: Callus, score: 85.782	N	N	N	N
vg1117614573	T -> G	LOC_Os11g30350.1	downstream_gene_variant ; 2025.0bp to feature; MODIFIER	silent_mutation	Average:46.836; most accessible tissue: Callus, score: 85.782	N	N	N	N
vg1117614573	T -> G	LOC_Os11g30320-LOC_Os11g30340	intergenic_region ; MODIFIER	silent_mutation	Average:46.836; most accessible tissue: Callus, score: 85.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117614573	NA	1.03E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	NA	5.35E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	NA	1.24E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	1.25E-06	1.25E-06	mr1576	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	NA	9.89E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	NA	7.24E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	NA	7.36E-08	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117614573	NA	1.10E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251