\
| Variant ID: vg1117597342 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17597342 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTAGTGAGATATCTCTATCTCTACTATTATAAAAATCAAATATATTTTTACCGGTACATCATCCGTGTATGAGTTGGTTTTTAAGTTCATTCGCTTTAC[A/G]
AAATACAGAAGGATCTTTTGTCGAAATACATATGCGTATTTGAGTCGTTTTTAAATTCGTTCGCTTTTGGAAATACAGGAGGCGTCATATAAGAAATATC
GATATTTCTTATATGACGCCTCCTGTATTTCCAAAAGCGAACGAATTTAAAAACGACTCAAATACGCATATGTATTTCGACAAAAGATCCTTCTGTATTT[T/C]
GTAAAGCGAATGAACTTAAAAACCAACTCATACACGGATGATGTACCGGTAAAAATATATTTGATTTTTATAATAGTAGAGATAGAGATATCTCACTAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 9.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117597342 | A -> G | LOC_Os11g30270.1 | upstream_gene_variant ; 4303.0bp to feature; MODIFIER | silent_mutation | Average:43.57; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1117597342 | A -> G | LOC_Os11g30280.1 | upstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:43.57; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1117597342 | A -> G | LOC_Os11g30290.1 | upstream_gene_variant ; 453.0bp to feature; MODIFIER | silent_mutation | Average:43.57; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1117597342 | A -> G | LOC_Os11g30300.1 | downstream_gene_variant ; 1589.0bp to feature; MODIFIER | silent_mutation | Average:43.57; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1117597342 | A -> G | LOC_Os11g30310.1 | downstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:43.57; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1117597342 | A -> G | LOC_Os11g30290-LOC_Os11g30300 | intergenic_region ; MODIFIER | silent_mutation | Average:43.57; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117597342 | NA | 2.26E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 6.89E-07 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.04E-07 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 8.27E-06 | 8.27E-06 | mr1048 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.04E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 6.52E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.55E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 7.40E-08 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 1.89E-06 | 1.89E-06 | mr1058 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.74E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 7.23E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.82E-06 | mr1084 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.86E-06 | mr1156 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.90E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.04E-08 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 5.81E-06 | 8.94E-09 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.87E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 6.03E-06 | 3.84E-07 | mr1266 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.95E-07 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.48E-07 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.63E-07 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.15E-07 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 6.86E-07 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.28E-06 | mr1288 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.90E-07 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.32E-06 | mr1297 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 7.83E-06 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.63E-06 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.20E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.15E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 5.67E-06 | 5.69E-06 | mr1356 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.78E-07 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 7.85E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.92E-08 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 1.02E-06 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 2.95E-06 | NA | mr1407 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 2.97E-06 | 2.97E-06 | mr1407 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.96E-08 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 1.26E-07 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 1.18E-06 | mr1433 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.19E-06 | mr1444 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.12E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 1.07E-06 | mr1483 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 8.34E-06 | 8.34E-06 | mr1483 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 6.68E-07 | mr1501 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 4.53E-06 | 4.53E-06 | mr1501 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 1.88E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.21E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 1.41E-07 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 8.58E-06 | mr1635 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 9.86E-06 | mr1640 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 3.26E-06 | 2.22E-07 | mr1656 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.41E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.32E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 8.27E-06 | 8.27E-06 | mr1724 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 7.45E-07 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 6.53E-09 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 9.25E-07 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.97E-06 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.41E-07 | mr1757 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.36E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 3.70E-06 | 3.46E-08 | mr1854 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 8.43E-08 | 8.43E-08 | mr1854 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 9.69E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.50E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | 1.52E-06 | 1.68E-08 | mr1943 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.10E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 2.95E-06 | mr1956 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 8.23E-07 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.88E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 5.43E-06 | mr1963 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 3.36E-06 | mr1972 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 6.56E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117597342 | NA | 4.93E-07 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |