Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117593072:

Variant ID: vg1117593072 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17593072
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCCACTCAGCAGTAACTTCGCCACGCTTTCGACGGCCCTTGTACATCCAACTGCGATCAGTTTCCATTGTACCTAGTTATGACAAAGTGATAGAATAAA[A/T]
TTATGTTAGGAAATGTCCTTCTATTCATGAAAGGTTCAAGAATAAGAAAGGCCTAGTTTAGTTTGTATGACTGAGAAATAAAATATCAAACATTAGTTCA

Reverse complement sequence

TGAACTAATGTTTGATATTTTATTTCTCAGTCATACAAACTAAACTAGGCCTTTCTTATTCTTGAACCTTTCATGAATAGAAGGACATTTCCTAACATAA[T/A]
TTTATTCTATCACTTTGTCATAACTAGGTACAATGGAAACTGATCGCAGTTGGATGTACAAGGGCCGTCGAAAGCGTGGCGAAGTTACTGCTGAGTGGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.80%	10.90%	9.37%	53.89%	NA
All Indica	2759	4.70%	9.40%	10.22%	75.72%	NA
All Japonica	1512	66.10%	16.10%	1.12%	16.73%	NA
Aus	269	8.20%	0.70%	43.87%	47.21%	NA
Indica I	595	11.90%	2.20%	5.38%	80.50%	NA
Indica II	465	0.90%	0.60%	18.49%	80.00%	NA
Indica III	913	1.60%	16.60%	9.75%	71.96%	NA
Indica Intermediate	786	5.00%	11.60%	9.54%	73.92%	NA
Temperate Japonica	767	66.90%	30.40%	0.13%	2.61%	NA
Tropical Japonica	504	57.10%	0.40%	2.18%	40.28%	NA
Japonica Intermediate	241	82.20%	3.30%	2.07%	12.45%	NA
VI/Aromatic	96	49.00%	1.00%	15.62%	34.38%	NA
Intermediate	90	26.70%	11.10%	12.22%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117593072	A -> T	LOC_Os11g30260.1	upstream_gene_variant ; 3531.0bp to feature; MODIFIER	silent_mutation	Average:6.999; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1117593072	A -> T	LOC_Os11g30270.1	upstream_gene_variant ; 33.0bp to feature; MODIFIER	silent_mutation	Average:6.999; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1117593072	A -> T	LOC_Os11g30280.1	downstream_gene_variant ; 1109.0bp to feature; MODIFIER	silent_mutation	Average:6.999; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1117593072	A -> T	LOC_Os11g30290.1	downstream_gene_variant ; 3428.0bp to feature; MODIFIER	silent_mutation	Average:6.999; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1117593072	A -> T	LOC_Os11g30270-LOC_Os11g30280	intergenic_region ; MODIFIER	silent_mutation	Average:6.999; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N
vg1117593072	A -> DEL	N	N	silent_mutation	Average:6.999; most accessible tissue: Zhenshan97 root, score: 12.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117593072	NA	2.45E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	1.78E-06	NA	mr1343	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	1.68E-06	1.68E-06	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	3.59E-10	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	2.91E-09	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	2.75E-08	NA	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	3.37E-09	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	1.50E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	5.92E-06	3.58E-13	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	1.91E-11	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	6.19E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	2.00E-06	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	6.63E-09	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	5.24E-06	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117593072	NA	1.00E-09	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251