Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117585468:

Variant ID: vg1117585468 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17585468
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGAGTTTTGATTTTTATTCCCGGTTAGTAACATCAACCAGGACTAAATTTAGGTTTTTAGTCCCGGTTGGTGTTACTAACCGGGACTAAAGATCCTAG[G/T]
GCCCTGACACGGCCTGACATGGAATCAACTGAGACTAACCGTCCTGATGACCTTTAGTCCCGGTTGGTGTTACTAACCGGGGCTAAAGATGATTTTTAGT

Reverse complement sequence

ACTAAAAATCATCTTTAGCCCCGGTTAGTAACACCAACCGGGACTAAAGGTCATCAGGACGGTTAGTCTCAGTTGATTCCATGTCAGGCCGTGTCAGGGC[C/A]
CTAGGATCTTTAGTCCCGGTTAGTAACACCAACCGGGACTAAAAACCTAAATTTAGTCCTGGTTGATGTTACTAACCGGGAATAAAAATCAAAACTCACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	11.10%	0.25%	0.11%	NA
All Indica	2759	80.80%	18.70%	0.40%	0.18%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	91.60%	8.00%	0.22%	0.22%	NA
Indica III	913	68.00%	30.80%	0.99%	0.22%	NA
Indica Intermediate	786	79.00%	20.60%	0.13%	0.25%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117585468	G -> T	LOC_Os11g30250.1	upstream_gene_variant ; 363.0bp to feature; MODIFIER	silent_mutation	Average:39.618; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg1117585468	G -> T	LOC_Os11g30240.1	downstream_gene_variant ; 3202.0bp to feature; MODIFIER	silent_mutation	Average:39.618; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg1117585468	G -> T	LOC_Os11g30260.1	downstream_gene_variant ; 3298.0bp to feature; MODIFIER	silent_mutation	Average:39.618; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg1117585468	G -> T	LOC_Os11g30240-LOC_Os11g30250	intergenic_region ; MODIFIER	silent_mutation	Average:39.618; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg1117585468	G -> DEL	N	N	silent_mutation	Average:39.618; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117585468	9.72E-06	1.20E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117585468	5.08E-06	1.76E-07	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117585468	8.31E-07	9.95E-08	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117585468	1.62E-06	8.82E-09	mr1528_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251