\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117569414:

Variant ID: vg1117569414 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17569414
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTGTGTGTAGAGGTGGTGACAGCCCTCAAAATACTAAAGTCCTCCCTGTCCGTGTACGTTGTAGAGCCATATCTGGGAGCAGCAGGCTGGCCAGCGC[C/T]
CGAAGCCAGCTCCCGATGTACCTTGTTAGGATTAAATTGAGCTTTCTGTAGACACTATCTCTCACTAGTAAATCATCTCTACCCTTAGCCTATCTTAGCT

Reverse complement sequence

AGCTAAGATAGGCTAAGGGTAGAGATGATTTACTAGTGAGAGATAGTGTCTACAGAAAGCTCAATTTAATCCTAACAAGGTACATCGGGAGCTGGCTTCG[G/A]
GCGCTGGCCAGCCTGCTGCTCCCAGATATGGCTCTACAACGTACACGGACAGGGAGGACTTTAGTATTTTGAGGGCTGTCACCACCTCTACACACACCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 34.60% 1.76% 3.47% NA
All Indica  2759 43.30% 52.50% 1.09% 3.12% NA
All Japonica  1512 83.70% 9.70% 2.78% 3.90% NA
Aus  269 91.80% 6.30% 1.12% 0.74% NA
Indica I  595 31.30% 67.90% 0.84% 0.00% NA
Indica II  465 54.40% 44.50% 0.86% 0.22% NA
Indica III  913 45.90% 45.30% 1.42% 7.34% NA
Indica Intermediate  786 42.70% 53.90% 1.02% 2.29% NA
Temperate Japonica  767 98.30% 1.40% 0.13% 0.13% NA
Tropical Japonica  504 59.10% 23.60% 7.34% 9.92% NA
Japonica Intermediate  241 88.40% 6.60% 1.66% 3.32% NA
VI/Aromatic  96 76.00% 7.30% 5.21% 11.46% NA
Intermediate  90 72.20% 17.80% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117569414 C -> T LOC_Os11g30210.1 upstream_gene_variant ; 4237.0bp to feature; MODIFIER silent_mutation Average:65.489; most accessible tissue: Minghui63 flag leaf, score: 92.129 N N N N
vg1117569414 C -> T LOC_Os11g30220.1 upstream_gene_variant ; 2026.0bp to feature; MODIFIER silent_mutation Average:65.489; most accessible tissue: Minghui63 flag leaf, score: 92.129 N N N N
vg1117569414 C -> T LOC_Os11g30210-LOC_Os11g30220 intergenic_region ; MODIFIER silent_mutation Average:65.489; most accessible tissue: Minghui63 flag leaf, score: 92.129 N N N N
vg1117569414 C -> DEL N N silent_mutation Average:65.489; most accessible tissue: Minghui63 flag leaf, score: 92.129 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117569414 C T -0.04 -0.04 -0.03 -0.04 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117569414 3.86E-06 3.86E-06 mr1151 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 7.84E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 9.08E-06 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 6.53E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 8.55E-06 8.55E-06 mr1351 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 3.61E-06 3.61E-06 mr1429 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 5.48E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 6.47E-06 6.47E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 3.56E-06 3.56E-06 mr1513 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 8.68E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 8.26E-07 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 8.77E-06 mr1594 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 7.84E-06 7.84E-06 mr1890 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 8.28E-06 8.28E-06 mr1891 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 1.88E-07 1.88E-07 mr1964 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117569414 NA 6.29E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251