\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117567707:

Variant ID: vg1117567707 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 17567707
Reference Allele: AAlternative Allele: G,AC
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGATTGAAGATGTTGGGCTGAGTATGTCTAAGGGCCTGTTCACCTTGATGCCAAAAAAAACCTTACCAAATTTTGGCATTGACAAATTTTGGTATAGTT[A/G,AC]
CTAAAATTTTGGCAAACTTGCCAAAATTTTGACATGATTTCTTATATAGTTACCAAAAATTTGGTAGCAAACTAAATGTAGCCACTTTTTTGACAACTTT

Reverse complement sequence

AAAGTTGTCAAAAAAGTGGCTACATTTAGTTTGCTACCAAATTTTTGGTAACTATATAAGAAATCATGTCAAAATTTTGGCAAGTTTGCCAAAATTTTAG[T/C,GT]
AACTATACCAAAATTTGTCAATGCCAAAATTTGGTAAGGTTTTTTTTGGCATCAAGGTGAACAGGCCCTTAGACATACTCAGCCCAACATCTTCAATCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 1.60% 6.33% 36.52% AC: 0.04%
All Indica  2759 36.20% 2.70% 8.45% 52.56% AC: 0.07%
All Japonica  1512 83.00% 0.10% 1.92% 15.01% NA
Aus  269 89.20% 0.40% 1.86% 8.55% NA
Indica I  595 28.90% 1.50% 5.38% 64.03% AC: 0.17%
Indica II  465 33.80% 4.10% 4.73% 57.20% AC: 0.22%
Indica III  913 40.40% 1.80% 11.39% 46.44% NA
Indica Intermediate  786 38.30% 3.90% 9.54% 48.22% NA
Temperate Japonica  767 97.80% 0.00% 0.65% 1.56% NA
Tropical Japonica  504 58.30% 0.00% 4.76% 36.90% NA
Japonica Intermediate  241 87.60% 0.40% 0.00% 12.03% NA
VI/Aromatic  96 76.00% 0.00% 22.92% 1.04% NA
Intermediate  90 61.10% 0.00% 11.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117567707 A -> AC LOC_Os11g30210.1 upstream_gene_variant ; 2531.0bp to feature; MODIFIER silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1117567707 A -> AC LOC_Os11g30220.1 upstream_gene_variant ; 3732.0bp to feature; MODIFIER silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1117567707 A -> AC LOC_Os11g30210-LOC_Os11g30220 intergenic_region ; MODIFIER silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1117567707 A -> DEL N N silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1117567707 A -> G LOC_Os11g30210.1 upstream_gene_variant ; 2530.0bp to feature; MODIFIER silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1117567707 A -> G LOC_Os11g30220.1 upstream_gene_variant ; 3733.0bp to feature; MODIFIER silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N
vg1117567707 A -> G LOC_Os11g30210-LOC_Os11g30220 intergenic_region ; MODIFIER silent_mutation Average:74.668; most accessible tissue: Minghui63 flag leaf, score: 92.945 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117567707 A AC 0.01 0.05 0.03 0.02 -0.01 -0.03
vg1117567707 A G -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117567707 NA 3.50E-06 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 1.75E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 4.50E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 7.23E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 1.97E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 5.34E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 1.32E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 8.27E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 3.91E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 3.25E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 8.56E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 2.02E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 7.55E-06 mr1402 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 7.15E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 9.35E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 9.10E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 6.15E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 7.05E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 5.53E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 1.12E-06 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 2.04E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 8.14E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 8.11E-09 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 8.45E-07 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 6.34E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 2.44E-07 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 2.14E-06 mr1758 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 2.21E-07 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 3.60E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 4.21E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 3.38E-07 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 9.34E-08 mr1968 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 9.54E-09 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 3.73E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117567707 NA 3.38E-06 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251