\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117565966:

Variant ID: vg1117565966 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17565966
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTAGGTGAGTGTCCCGTGGACATTGCTCCCACCCCACATTTTACCGTTCCACCCCTCGCCCTCGTCGTTGGAAGTAGGCGACGACCCTGCGACGGCGA[C/T]
GACTCGGCGACGGGCGGAGGAAGAGGGGTGGCGGCACGGCACACGGCATCCGGCGATGACCCCGCGACGAGAGAGAGAGAGAGGAGAGATGGATCCGGTG

Reverse complement sequence

CACCGGATCCATCTCTCCTCTCTCTCTCTCTCGTCGCGGGGTCATCGCCGGATGCCGTGTGCCGTGCCGCCACCCCTCTTCCTCCGCCCGTCGCCGAGTC[G/A]
TCGCCGTCGCAGGGTCGTCGCCTACTTCCAACGACGAGGGCGAGGGGTGGAACGGTAAAATGTGGGGTGGGAGCAATGTCCACGGGACACTCACCTAGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 25.20% 0.17% 4.51% NA
All Indica  2759 66.90% 25.40% 0.25% 7.43% NA
All Japonica  1512 69.00% 30.70% 0.07% 0.26% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 86.60% 9.60% 0.50% 3.36% NA
Indica II  465 71.60% 10.50% 0.22% 17.63% NA
Indica III  913 51.00% 42.70% 0.00% 6.24% NA
Indica Intermediate  786 67.70% 26.10% 0.38% 5.85% NA
Temperate Japonica  767 68.40% 31.00% 0.13% 0.39% NA
Tropical Japonica  504 61.70% 38.30% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 13.70% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 80.00% 15.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117565966 C -> T LOC_Os11g30200.1 upstream_gene_variant ; 4832.0bp to feature; MODIFIER silent_mutation Average:85.72; most accessible tissue: Minghui63 flag leaf, score: 98.144 N N N N
vg1117565966 C -> T LOC_Os11g30210.1 upstream_gene_variant ; 789.0bp to feature; MODIFIER silent_mutation Average:85.72; most accessible tissue: Minghui63 flag leaf, score: 98.144 N N N N
vg1117565966 C -> T LOC_Os11g30210-LOC_Os11g30220 intergenic_region ; MODIFIER silent_mutation Average:85.72; most accessible tissue: Minghui63 flag leaf, score: 98.144 N N N N
vg1117565966 C -> DEL N N silent_mutation Average:85.72; most accessible tissue: Minghui63 flag leaf, score: 98.144 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117565966 C T -0.01 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117565966 NA 1.09E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117565966 NA 7.83E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117565966 NA 3.45E-07 mr1265_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117565966 NA 1.64E-08 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117565966 NA 4.32E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117565966 NA 8.94E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251