\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117554396:

Variant ID: vg1117554396 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17554396
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCCGTTTGTTTGGCTGGCCAAGAGGAGTTAGGCTTTTTTTCCGTTTGTTTGGCTAGCCAAGAGGAGTTAGGCCTGGTTTAGTTCCTAAATTTTTTT[C/T]
ACAAAAATATCACATCGAATCTTTAGACATATATATAGAGCATTAAATATATATTAAAAATAGACTAATTGCATAGTTAGGAGGAAAATTGCAAGACGAA

Reverse complement sequence

TTCGTCTTGCAATTTTCCTCCTAACTATGCAATTAGTCTATTTTTAATATATATTTAATGCTCTATATATATGTCTAAAGATTCGATGTGATATTTTTGT[G/A]
AAAAAAATTTAGGAACTAAACCAGGCCTAACTCCTCTTGGCTAGCCAAACAAACGGAAAAAAAGCCTAACTCCTCTTGGCCAGCCAAACAAACGGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 8.30% 0.61% 43.00% NA
All Indica  2759 23.60% 13.60% 0.72% 62.05% NA
All Japonica  1512 83.20% 0.30% 0.40% 16.14% NA
Aus  269 90.00% 0.00% 0.37% 9.67% NA
Indica I  595 15.60% 13.80% 0.84% 69.75% NA
Indica II  465 17.80% 17.40% 0.65% 64.09% NA
Indica III  913 26.90% 14.10% 0.22% 58.71% NA
Indica Intermediate  786 29.10% 10.70% 1.27% 58.91% NA
Temperate Japonica  767 97.70% 0.10% 0.13% 2.09% NA
Tropical Japonica  504 59.30% 0.40% 0.99% 39.29% NA
Japonica Intermediate  241 87.10% 0.40% 0.00% 12.45% NA
VI/Aromatic  96 76.00% 1.00% 0.00% 22.92% NA
Intermediate  90 55.60% 11.10% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117554396 C -> T LOC_Os11g30200.1 downstream_gene_variant ; 4399.0bp to feature; MODIFIER silent_mutation Average:14.371; most accessible tissue: Callus, score: 77.598 N N N N
vg1117554396 C -> T LOC_Os11g30190-LOC_Os11g30200 intergenic_region ; MODIFIER silent_mutation Average:14.371; most accessible tissue: Callus, score: 77.598 N N N N
vg1117554396 C -> DEL N N silent_mutation Average:14.371; most accessible tissue: Callus, score: 77.598 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117554396 NA 2.28E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 5.02E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.46E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 6.90E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.54E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 1.40E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 1.98E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.64E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.61E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.66E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 5.39E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.24E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 6.55E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 4.22E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 7.42E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 4.15E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 6.85E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.80E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 1.14E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.53E-06 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 8.76E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 5.94E-07 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 4.60E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.90E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 4.22E-07 mr1483 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 6.71E-06 6.71E-06 mr1483 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 1.62E-06 mr1501 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 9.23E-06 9.23E-06 mr1501 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 6.45E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 1.06E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.21E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.78E-08 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 4.20E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 9.40E-06 mr1757 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 5.38E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.12E-06 mr1854 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 5.30E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 1.49E-06 3.10E-08 mr1943 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 8.36E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.38E-10 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.96E-09 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 2.99E-06 mr1963 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 5.43E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 1.58E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.84E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554396 NA 3.93E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251