Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117554106:

Variant ID: vg1117554106 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17554106
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTTTTGTGATAAAACAACTCCTAACAAAATAAATAATAGTTATGAAAAATTTAAATAAGATAAATAATTAAATATATATTTAAAAGTTAACGACATC[T/G,A]
TCTATTAAAAACGAACGTAGTATCTTATATCAAAAGAACGAATGAAAAAAAAAACAGCCAAAAGATACGGCTCGGTGAGATTGGCTCGACTCCAAAGATG

Reverse complement sequence

CATCTTTGGAGTCGAGCCAATCTCACCGAGCCGTATCTTTTGGCTGTTTTTTTTTTCATTCGTTCTTTTGATATAAGATACTACGTTCGTTTTTAATAGA[A/C,T]
GATGTCGTTAACTTTTAAATATATATTTAATTATTTATCTTATTTAAATTTTTCATAACTATTATTTATTTTGTTAGGAGTTGTTTTATCACAAAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	25.90%	0.53%	44.37%	A: 0.04%
All Indica	2759	30.70%	4.50%	0.69%	64.04%	NA
All Japonica	1512	16.70%	66.50%	0.13%	16.67%	NA
Aus	269	82.90%	7.40%	0.37%	9.29%	NA
Indica I	595	17.00%	11.10%	0.50%	71.43%	NA
Indica II	465	32.30%	2.40%	0.43%	64.95%	NA
Indica III	913	36.90%	1.80%	0.22%	61.12%	NA
Indica Intermediate	786	33.10%	4.10%	1.53%	61.32%	NA
Temperate Japonica	767	30.00%	67.70%	0.00%	2.35%	NA
Tropical Japonica	504	1.80%	57.30%	0.40%	40.48%	NA
Japonica Intermediate	241	5.40%	82.20%	0.00%	12.45%	NA
VI/Aromatic	96	29.20%	45.80%	1.04%	23.96%	NA
Intermediate	90	31.10%	31.10%	2.22%	33.33%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117554106	T -> DEL	N	N	silent_mutation	Average:13.582; most accessible tissue: Callus, score: 85.888	N	N	N	N
vg1117554106	T -> A	LOC_Os11g30200.1	downstream_gene_variant ; 4689.0bp to feature; MODIFIER	silent_mutation	Average:13.582; most accessible tissue: Callus, score: 85.888	N	N	N	N
vg1117554106	T -> A	LOC_Os11g30190-LOC_Os11g30200	intergenic_region ; MODIFIER	silent_mutation	Average:13.582; most accessible tissue: Callus, score: 85.888	N	N	N	N
vg1117554106	T -> G	LOC_Os11g30200.1	downstream_gene_variant ; 4689.0bp to feature; MODIFIER	silent_mutation	Average:13.582; most accessible tissue: Callus, score: 85.888	N	N	N	N
vg1117554106	T -> G	LOC_Os11g30190-LOC_Os11g30200	intergenic_region ; MODIFIER	silent_mutation	Average:13.582; most accessible tissue: Callus, score: 85.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117554106	NA	4.91E-09	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	2.06E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	8.08E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	7.77E-06	9.59E-12	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	9.58E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	5.17E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	1.45E-07	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	2.25E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106	NA	3.79E-07	mr1966_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251