\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117554106:

Variant ID: vg1117554106 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17554106
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTTTTGTGATAAAACAACTCCTAACAAAATAAATAATAGTTATGAAAAATTTAAATAAGATAAATAATTAAATATATATTTAAAAGTTAACGACATC[T/G,A]
TCTATTAAAAACGAACGTAGTATCTTATATCAAAAGAACGAATGAAAAAAAAAACAGCCAAAAGATACGGCTCGGTGAGATTGGCTCGACTCCAAAGATG

Reverse complement sequence

CATCTTTGGAGTCGAGCCAATCTCACCGAGCCGTATCTTTTGGCTGTTTTTTTTTTCATTCGTTCTTTTGATATAAGATACTACGTTCGTTTTTAATAGA[A/C,T]
GATGTCGTTAACTTTTAAATATATATTTAATTATTTATCTTATTTAAATTTTTCATAACTATTATTTATTTTGTTAGGAGTTGTTTTATCACAAAAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 25.90% 0.53% 44.37% A: 0.04%
All Indica  2759 30.70% 4.50% 0.69% 64.04% NA
All Japonica  1512 16.70% 66.50% 0.13% 16.67% NA
Aus  269 82.90% 7.40% 0.37% 9.29% NA
Indica I  595 17.00% 11.10% 0.50% 71.43% NA
Indica II  465 32.30% 2.40% 0.43% 64.95% NA
Indica III  913 36.90% 1.80% 0.22% 61.12% NA
Indica Intermediate  786 33.10% 4.10% 1.53% 61.32% NA
Temperate Japonica  767 30.00% 67.70% 0.00% 2.35% NA
Tropical Japonica  504 1.80% 57.30% 0.40% 40.48% NA
Japonica Intermediate  241 5.40% 82.20% 0.00% 12.45% NA
VI/Aromatic  96 29.20% 45.80% 1.04% 23.96% NA
Intermediate  90 31.10% 31.10% 2.22% 33.33% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117554106 T -> DEL N N silent_mutation Average:13.582; most accessible tissue: Callus, score: 85.888 N N N N
vg1117554106 T -> A LOC_Os11g30200.1 downstream_gene_variant ; 4689.0bp to feature; MODIFIER silent_mutation Average:13.582; most accessible tissue: Callus, score: 85.888 N N N N
vg1117554106 T -> A LOC_Os11g30190-LOC_Os11g30200 intergenic_region ; MODIFIER silent_mutation Average:13.582; most accessible tissue: Callus, score: 85.888 N N N N
vg1117554106 T -> G LOC_Os11g30200.1 downstream_gene_variant ; 4689.0bp to feature; MODIFIER silent_mutation Average:13.582; most accessible tissue: Callus, score: 85.888 N N N N
vg1117554106 T -> G LOC_Os11g30190-LOC_Os11g30200 intergenic_region ; MODIFIER silent_mutation Average:13.582; most accessible tissue: Callus, score: 85.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117554106 NA 4.91E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 2.06E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 8.08E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 7.77E-06 9.59E-12 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 9.58E-09 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 5.17E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 1.45E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 2.25E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117554106 NA 3.79E-07 mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251