\
| Variant ID: vg1117554106 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17554106 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 45. )
ATATTTTTGTGATAAAACAACTCCTAACAAAATAAATAATAGTTATGAAAAATTTAAATAAGATAAATAATTAAATATATATTTAAAAGTTAACGACATC[T/G,A]
TCTATTAAAAACGAACGTAGTATCTTATATCAAAAGAACGAATGAAAAAAAAAACAGCCAAAAGATACGGCTCGGTGAGATTGGCTCGACTCCAAAGATG
CATCTTTGGAGTCGAGCCAATCTCACCGAGCCGTATCTTTTGGCTGTTTTTTTTTTCATTCGTTCTTTTGATATAAGATACTACGTTCGTTTTTAATAGA[A/C,T]
GATGTCGTTAACTTTTAAATATATATTTAATTATTTATCTTATTTAAATTTTTCATAACTATTATTTATTTTGTTAGGAGTTGTTTTATCACAAAAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.20% | 25.90% | 0.53% | 44.37% | A: 0.04% |
| All Indica | 2759 | 30.70% | 4.50% | 0.69% | 64.04% | NA |
| All Japonica | 1512 | 16.70% | 66.50% | 0.13% | 16.67% | NA |
| Aus | 269 | 82.90% | 7.40% | 0.37% | 9.29% | NA |
| Indica I | 595 | 17.00% | 11.10% | 0.50% | 71.43% | NA |
| Indica II | 465 | 32.30% | 2.40% | 0.43% | 64.95% | NA |
| Indica III | 913 | 36.90% | 1.80% | 0.22% | 61.12% | NA |
| Indica Intermediate | 786 | 33.10% | 4.10% | 1.53% | 61.32% | NA |
| Temperate Japonica | 767 | 30.00% | 67.70% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 1.80% | 57.30% | 0.40% | 40.48% | NA |
| Japonica Intermediate | 241 | 5.40% | 82.20% | 0.00% | 12.45% | NA |
| VI/Aromatic | 96 | 29.20% | 45.80% | 1.04% | 23.96% | NA |
| Intermediate | 90 | 31.10% | 31.10% | 2.22% | 33.33% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117554106 | T -> DEL | N | N | silent_mutation | Average:13.582; most accessible tissue: Callus, score: 85.888 | N | N | N | N |
| vg1117554106 | T -> A | LOC_Os11g30200.1 | downstream_gene_variant ; 4689.0bp to feature; MODIFIER | silent_mutation | Average:13.582; most accessible tissue: Callus, score: 85.888 | N | N | N | N |
| vg1117554106 | T -> A | LOC_Os11g30190-LOC_Os11g30200 | intergenic_region ; MODIFIER | silent_mutation | Average:13.582; most accessible tissue: Callus, score: 85.888 | N | N | N | N |
| vg1117554106 | T -> G | LOC_Os11g30200.1 | downstream_gene_variant ; 4689.0bp to feature; MODIFIER | silent_mutation | Average:13.582; most accessible tissue: Callus, score: 85.888 | N | N | N | N |
| vg1117554106 | T -> G | LOC_Os11g30190-LOC_Os11g30200 | intergenic_region ; MODIFIER | silent_mutation | Average:13.582; most accessible tissue: Callus, score: 85.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117554106 | NA | 4.91E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 2.06E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 8.08E-07 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | 7.77E-06 | 9.59E-12 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 9.58E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 5.17E-10 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 1.45E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 2.25E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117554106 | NA | 3.79E-07 | mr1966_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |