\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117553288:

Variant ID: vg1117553288 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17553288
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGGAGGGTGCAGGAGGGGGCGTGGGGAGGAGATCGATCCGAGAAAGGAGCGAGCGTGGGGAGGAGATCGGTCGTTGGATGTGGCAATCGGATGGTC[A/G]
AGATTACGCGTGTCTATCAGATGCATCTGCTGTGCCAGGAATCAAGACCACTACTACAGATTTTTTAAGTAGTAGAGATGACAGACGTGAACGTGGGCTA

Reverse complement sequence

TAGCCCACGTTCACGTCTGTCATCTCTACTACTTAAAAAATCTGTAGTAGTGGTCTTGATTCCTGGCACAGCAGATGCATCTGATAGACACGCGTAATCT[T/C]
GACCATCCGATTGCCACATCCAACGACCGATCTCCTCCCCACGCTCGCTCCTTTCTCGGATCGATCTCCTCCCCACGCCCCCTCCTGCACCCTCCTCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.50% 26.30% 0.89% 43.38% NA
All Indica  2759 31.20% 5.00% 1.38% 62.38% NA
All Japonica  1512 16.60% 66.70% 0.00% 16.73% NA
Aus  269 83.60% 7.10% 0.74% 8.55% NA
Indica I  595 17.00% 11.30% 0.84% 70.92% NA
Indica II  465 32.00% 3.20% 1.51% 63.23% NA
Indica III  913 37.60% 2.20% 1.10% 59.15% NA
Indica Intermediate  786 34.10% 4.70% 2.04% 59.16% NA
Temperate Japonica  767 29.90% 67.90% 0.00% 2.22% NA
Tropical Japonica  504 1.80% 57.30% 0.00% 40.87% NA
Japonica Intermediate  241 5.40% 82.20% 0.00% 12.45% NA
VI/Aromatic  96 29.20% 45.80% 0.00% 25.00% NA
Intermediate  90 31.10% 34.40% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117553288 A -> DEL N N silent_mutation Average:16.223; most accessible tissue: Callus, score: 58.923 N N N N
vg1117553288 A -> G LOC_Os11g30190.1 downstream_gene_variant ; 4464.0bp to feature; MODIFIER silent_mutation Average:16.223; most accessible tissue: Callus, score: 58.923 N N N N
vg1117553288 A -> G LOC_Os11g30190-LOC_Os11g30200 intergenic_region ; MODIFIER silent_mutation Average:16.223; most accessible tissue: Callus, score: 58.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117553288 NA 6.40E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 4.63E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 2.17E-07 2.17E-07 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 2.91E-11 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 8.69E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 2.88E-08 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 8.32E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 5.38E-11 mr1829 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 5.73E-07 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 1.36E-07 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 8.92E-15 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 4.40E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 5.45E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 2.31E-11 mr1829_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117553288 NA 3.53E-12 mr1902_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251