\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117548144:

Variant ID: vg1117548144 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17548144
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTTGGTGAGCTATGGTGTTTTTAACCGGGACTGAAGATCATTTTTAGTCCCGGTTTTTATCGCGATCGGGACTATTGTGGATTTTGGCCGACCGACCA[T/A]
AGATGGTTTCTCCACCAGTGATGGCTACGGAGCGGAAAGGAAGATTGAAGTGCGCCAGATGGGAACACGTGTGGAAGCCTTCGTACCGTTTTAAACTCGA

Reverse complement sequence

TCGAGTTTAAAACGGTACGAAGGCTTCCACACGTGTTCCCATCTGGCGCACTTCAATCTTCCTTTCCGCTCCGTAGCCATCACTGGTGGAGAAACCATCT[A/T]
TGGTCGGTCGGCCAAAATCCACAATAGTCCCGATCGCGATAAAAACCGGGACTAAAAATGATCTTCAGTCCCGGTTAAAAACACCATAGCTCACCAACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.40% 26.10% 0.38% 44.16% NA
All Indica  2759 30.80% 5.10% 0.58% 63.50% NA
All Japonica  1512 16.70% 66.40% 0.00% 16.87% NA
Aus  269 85.10% 4.80% 0.00% 10.04% NA
Indica I  595 17.00% 11.80% 0.50% 70.76% NA
Indica II  465 32.30% 3.00% 0.65% 64.09% NA
Indica III  913 37.10% 2.00% 0.11% 60.79% NA
Indica Intermediate  786 33.10% 5.00% 1.15% 60.81% NA
Temperate Japonica  767 30.00% 67.70% 0.00% 2.35% NA
Tropical Japonica  504 1.80% 57.10% 0.00% 41.07% NA
Japonica Intermediate  241 5.80% 81.70% 0.00% 12.45% NA
VI/Aromatic  96 29.20% 45.80% 1.04% 23.96% NA
Intermediate  90 32.20% 33.30% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117548144 T -> A LOC_Os11g30170.1 upstream_gene_variant ; 4333.0bp to feature; MODIFIER silent_mutation Average:8.479; most accessible tissue: Callus, score: 23.513 N N N N
vg1117548144 T -> A LOC_Os11g30190.1 upstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:8.479; most accessible tissue: Callus, score: 23.513 N N N N
vg1117548144 T -> A LOC_Os11g30180.1 downstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:8.479; most accessible tissue: Callus, score: 23.513 N N N N
vg1117548144 T -> A LOC_Os11g30180-LOC_Os11g30190 intergenic_region ; MODIFIER silent_mutation Average:8.479; most accessible tissue: Callus, score: 23.513 N N N N
vg1117548144 T -> DEL N N silent_mutation Average:8.479; most accessible tissue: Callus, score: 23.513 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117548144 NA 1.43E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 1.17E-07 1.17E-07 mr1343 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 2.00E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 5.08E-11 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 9.87E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 1.88E-10 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 4.63E-07 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 9.71E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 1.20E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 3.63E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 3.00E-14 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 9.98E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 5.26E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 3.82E-11 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144 NA 4.99E-12 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251