Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1117548144:

Variant ID: vg1117548144 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17548144
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTTGGTGAGCTATGGTGTTTTTAACCGGGACTGAAGATCATTTTTAGTCCCGGTTTTTATCGCGATCGGGACTATTGTGGATTTTGGCCGACCGACCA[T/A]
AGATGGTTTCTCCACCAGTGATGGCTACGGAGCGGAAAGGAAGATTGAAGTGCGCCAGATGGGAACACGTGTGGAAGCCTTCGTACCGTTTTAAACTCGA

Reverse complement sequence

TCGAGTTTAAAACGGTACGAAGGCTTCCACACGTGTTCCCATCTGGCGCACTTCAATCTTCCTTTCCGCTCCGTAGCCATCACTGGTGGAGAAACCATCT[A/T]
TGGTCGGTCGGCCAAAATCCACAATAGTCCCGATCGCGATAAAAACCGGGACTAAAAATGATCTTCAGTCCCGGTTAAAAACACCATAGCTCACCAACCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.40%	26.10%	0.38%	44.16%	NA
All Indica	2759	30.80%	5.10%	0.58%	63.50%	NA
All Japonica	1512	16.70%	66.40%	0.00%	16.87%	NA
Aus	269	85.10%	4.80%	0.00%	10.04%	NA
Indica I	595	17.00%	11.80%	0.50%	70.76%	NA
Indica II	465	32.30%	3.00%	0.65%	64.09%	NA
Indica III	913	37.10%	2.00%	0.11%	60.79%	NA
Indica Intermediate	786	33.10%	5.00%	1.15%	60.81%	NA
Temperate Japonica	767	30.00%	67.70%	0.00%	2.35%	NA
Tropical Japonica	504	1.80%	57.10%	0.00%	41.07%	NA
Japonica Intermediate	241	5.80%	81.70%	0.00%	12.45%	NA
VI/Aromatic	96	29.20%	45.80%	1.04%	23.96%	NA
Intermediate	90	32.20%	33.30%	1.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117548144	T -> A	LOC_Os11g30170.1	upstream_gene_variant ; 4333.0bp to feature; MODIFIER	silent_mutation	Average:8.479; most accessible tissue: Callus, score: 23.513	N	N	N	N
vg1117548144	T -> A	LOC_Os11g30190.1	upstream_gene_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:8.479; most accessible tissue: Callus, score: 23.513	N	N	N	N
vg1117548144	T -> A	LOC_Os11g30180.1	downstream_gene_variant ; 2410.0bp to feature; MODIFIER	silent_mutation	Average:8.479; most accessible tissue: Callus, score: 23.513	N	N	N	N
vg1117548144	T -> A	LOC_Os11g30180-LOC_Os11g30190	intergenic_region ; MODIFIER	silent_mutation	Average:8.479; most accessible tissue: Callus, score: 23.513	N	N	N	N
vg1117548144	T -> DEL	N	N	silent_mutation	Average:8.479; most accessible tissue: Callus, score: 23.513	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117548144	NA	1.43E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	1.17E-07	1.17E-07	mr1343	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	2.00E-09	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	5.08E-11	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	9.87E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	1.88E-10	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	4.63E-07	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	9.71E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	1.20E-06	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	3.63E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	3.00E-14	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	9.98E-06	mr1621_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	5.26E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	3.82E-11	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117548144	NA	4.99E-12	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251