\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117531985:

Variant ID: vg1117531985 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17531985
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAAGTTAGACTCAGCTGACAGAAGCTTGAGATTAGTTCAAATCTGGATGCATACAGATTTGGCAATCATTTTGCTGGGAATCTTGGCAGTATTAATTA[A/C]
ATCCAGACTAGACGGCCACTGGTATTAAGAAAGTTTTGTATTATCTGCAAAACAATTTTAAGTAACATGCTCATATTTCTAAAGTCCAATGATCTCAGAA

Reverse complement sequence

TTCTGAGATCATTGGACTTTAGAAATATGAGCATGTTACTTAAAATTGTTTTGCAGATAATACAAAACTTTCTTAATACCAGTGGCCGTCTAGTCTGGAT[T/G]
TAATTAATACTGCCAAGATTCCCAGCAAAATGATTGCCAAATCTGTATGCATCCAGATTTGAACTAATCTCAAGCTTCTGTCAGCTGAGTCTAACTTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 5.20% 8.27% 1.67% NA
All Indica  2759 88.70% 0.00% 11.16% 0.14% NA
All Japonica  1512 74.50% 15.80% 4.83% 4.83% NA
Aus  269 98.10% 0.00% 1.86% 0.00% NA
Indica I  595 72.60% 0.00% 27.39% 0.00% NA
Indica II  465 89.90% 0.00% 10.11% 0.00% NA
Indica III  913 97.80% 0.00% 2.19% 0.00% NA
Indica Intermediate  786 89.60% 0.00% 9.92% 0.51% NA
Temperate Japonica  767 69.00% 30.10% 0.65% 0.26% NA
Tropical Japonica  504 75.40% 0.40% 12.70% 11.51% NA
Japonica Intermediate  241 90.50% 2.50% 1.66% 5.39% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 4.40% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117531985 A -> DEL N N silent_mutation Average:9.244; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg1117531985 A -> C LOC_Os11g30150.1 downstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:9.244; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg1117531985 A -> C LOC_Os11g30150-LOC_Os11g30170 intergenic_region ; MODIFIER silent_mutation Average:9.244; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117531985 NA 5.11E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117531985 NA 8.23E-06 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 2.07E-06 4.54E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 1.23E-06 1.23E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 3.62E-06 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 6.84E-11 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 3.66E-09 2.52E-11 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 7.09E-10 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 1.58E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 3.01E-07 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 2.73E-08 1.14E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 5.44E-14 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 2.10E-06 2.10E-06 mr1525_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 7.09E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 9.69E-06 4.49E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 1.88E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 4.27E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 8.74E-06 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 4.17E-11 1.25E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 1.10E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 5.63E-10 1.22E-19 mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117531985 NA 2.97E-11 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251