\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117516119:

Variant ID: vg1117516119 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17516119
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGGCTGCCGAAGCTGTGAGGTGGCGGGGACCGCAGTGGTCCCGGCCGCGGTGATGAGGTGGTGGAGGCGGTGGCCGATGCGTCGGCAACCTTGACTGC[G/A]
AGATGGTGGCGGCCGCGGTATCGAGGTGGTGTCATACCCATGCCTAATGTGTAGTATATCCATGTTGGGTGATGACGAGTGGGCCCATGAAATGGGATGG

Reverse complement sequence

CCATCCCATTTCATGGGCCCACTCGTCATCACCCAACATGGATATACTACACATTAGGCATGGGTATGACACCACCTCGATACCGCGGCCGCCACCATCT[C/T]
GCAGTCAAGGTTGCCGACGCATCGGCCACCGCCTCCACCACCTCATCACCGCGGCCGGGACCACTGCGGTCCCCGCCACCTCACAGCTTCGGCAGCCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 8.90% 5.25% 31.70% NA
All Indica  2759 49.70% 0.30% 5.18% 44.84% NA
All Japonica  1512 54.70% 26.00% 4.89% 14.42% NA
Aus  269 91.10% 0.40% 1.49% 7.06% NA
Indica I  595 31.60% 0.30% 7.73% 60.34% NA
Indica II  465 41.50% 0.20% 4.73% 53.55% NA
Indica III  913 65.10% 0.10% 4.27% 30.56% NA
Indica Intermediate  786 50.30% 0.60% 4.58% 44.53% NA
Temperate Japonica  767 93.70% 2.60% 1.69% 1.96% NA
Tropical Japonica  504 4.80% 52.80% 7.14% 35.32% NA
Japonica Intermediate  241 34.90% 44.40% 10.37% 10.37% NA
VI/Aromatic  96 75.00% 5.20% 18.75% 1.04% NA
Intermediate  90 50.00% 14.40% 10.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117516119 G -> A LOC_Os11g30130.1 upstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:14.069; most accessible tissue: Callus, score: 53.24 N N N N
vg1117516119 G -> A LOC_Os11g30120.1 downstream_gene_variant ; 2280.0bp to feature; MODIFIER silent_mutation Average:14.069; most accessible tissue: Callus, score: 53.24 N N N N
vg1117516119 G -> A LOC_Os11g30140.1 downstream_gene_variant ; 4448.0bp to feature; MODIFIER silent_mutation Average:14.069; most accessible tissue: Callus, score: 53.24 N N N N
vg1117516119 G -> A LOC_Os11g30120-LOC_Os11g30130 intergenic_region ; MODIFIER silent_mutation Average:14.069; most accessible tissue: Callus, score: 53.24 N N N N
vg1117516119 G -> DEL N N silent_mutation Average:14.069; most accessible tissue: Callus, score: 53.24 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117516119 NA 1.44E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117516119 NA 6.73E-09 mr1509_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117516119 NA 1.84E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117516119 NA 2.18E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251