\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117508504:

Variant ID: vg1117508504 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17508504
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGTGCCTAGCCCTGTACATACATGTCCAGATGTTTTGGCTGTCATCTCTTCTGCTAACTCTCCCTTTTGACTTTACTTACTTGCTGAGTTCCTCATC[A/T]
GTTCCCTTCCTCTCTTTCCAAGCTTGCTTCCATCGTCGACATCTCCTCCTTGATCCGAGTAGCTCGTGATGGCCGGACTACTTGCCTCTCTGGCCATAAG

Reverse complement sequence

CTTATGGCCAGAGAGGCAAGTAGTCCGGCCATCACGAGCTACTCGGATCAAGGAGGAGATGTCGACGATGGAAGCAAGCTTGGAAAGAGAGGAAGGGAAC[T/A]
GATGAGGAACTCAGCAAGTAAGTAAAGTCAAAAGGGAGAGTTAGCAGAAGAGATGACAGCCAAAACATCTGGACATGTATGTACAGGGCTAGGCACATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 29.50% 0.06% 5.35% NA
All Indica  2759 43.20% 48.70% 0.11% 7.90% NA
All Japonica  1512 98.80% 0.90% 0.00% 0.33% NA
Aus  269 90.70% 7.80% 0.00% 1.49% NA
Indica I  595 34.10% 62.90% 0.17% 2.86% NA
Indica II  465 35.90% 46.50% 0.22% 17.42% NA
Indica III  913 50.40% 41.40% 0.00% 8.21% NA
Indica Intermediate  786 46.20% 48.00% 0.13% 5.73% NA
Temperate Japonica  767 98.70% 0.90% 0.00% 0.39% NA
Tropical Japonica  504 99.00% 0.80% 0.00% 0.20% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 80.20% 0.00% 0.00% 19.79% NA
Intermediate  90 75.60% 16.70% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117508504 A -> T LOC_Os11g30100.1 upstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:83.869; most accessible tissue: Zhenshan97 root, score: 98.728 N N N N
vg1117508504 A -> T LOC_Os11g30110.1 upstream_gene_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:83.869; most accessible tissue: Zhenshan97 root, score: 98.728 N N N N
vg1117508504 A -> T LOC_Os11g30090.1 downstream_gene_variant ; 3315.0bp to feature; MODIFIER silent_mutation Average:83.869; most accessible tissue: Zhenshan97 root, score: 98.728 N N N N
vg1117508504 A -> T LOC_Os11g30100-LOC_Os11g30110 intergenic_region ; MODIFIER silent_mutation Average:83.869; most accessible tissue: Zhenshan97 root, score: 98.728 N N N N
vg1117508504 A -> DEL N N silent_mutation Average:83.869; most accessible tissue: Zhenshan97 root, score: 98.728 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117508504 A T 0.07 0.06 0.03 0.02 0.05 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117508504 NA 2.13E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 1.50E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 8.34E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 5.80E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 2.90E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 1.49E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 1.69E-11 mr1970 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 2.73E-09 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 1.89E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 4.62E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117508504 NA 2.19E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251