Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117491108:

Variant ID: vg1117491108 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17491108
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.19, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGTTCTATTCTATTGATATTCATTAATATTGTGCTCACATTTATAACATAATGATATCTTTCAATTGTACGAACAAATAATGCAAAATCCAAATACGA[T/C]
ATAACACAATACATTATAATTATTATGCAATCAACTCTTGGTTTCAGCTTAAATAGAGTTAAGTGTTGGAAAAACTAAACCCACGGTGCTTAATTCTTCT

Reverse complement sequence

AGAAGAATTAAGCACCGTGGGTTTAGTTTTTCCAACACTTAACTCTATTTAAGCTGAAACCAAGAGTTGATTGCATAATAATTATAATGTATTGTGTTAT[A/G]
TCGTATTTGGATTTTGCATTATTTGTTCGTACAATTGAAAGATATCATTATGTTATAAATGTGAGCACAATATTAATGAATATCAATAGAATAGAACTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	43.00%	2.90%	3.13%	NA
All Indica	2759	29.00%	62.30%	4.35%	4.42%	NA
All Japonica	1512	82.70%	16.80%	0.07%	0.40%	NA
Aus	269	87.00%	11.20%	1.86%	0.00%	NA
Indica I	595	25.20%	70.90%	1.01%	2.86%	NA
Indica II	465	28.40%	51.20%	6.45%	13.98%	NA
Indica III	913	29.00%	63.70%	6.57%	0.66%	NA
Indica Intermediate	786	32.10%	60.60%	3.05%	4.33%	NA
Temperate Japonica	767	97.50%	1.80%	0.13%	0.52%	NA
Tropical Japonica	504	58.10%	41.70%	0.00%	0.20%	NA
Japonica Intermediate	241	87.10%	12.40%	0.00%	0.41%	NA
VI/Aromatic	96	75.00%	3.10%	8.33%	13.54%	NA
Intermediate	90	58.90%	30.00%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117491108	T -> DEL	N	N	silent_mutation	Average:22.859; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1117491108	T -> C	LOC_Os11g30070.1	upstream_gene_variant ; 4255.0bp to feature; MODIFIER	silent_mutation	Average:22.859; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1117491108	T -> C	LOC_Os11g30060.1	downstream_gene_variant ; 1553.0bp to feature; MODIFIER	silent_mutation	Average:22.859; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1117491108	T -> C	LOC_Os11g30060-LOC_Os11g30070	intergenic_region ; MODIFIER	silent_mutation	Average:22.859; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117491108	NA	9.84E-08	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117491108	NA	1.19E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117491108	NA	5.73E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117491108	NA	5.89E-08	mr1772	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117491108	NA	7.47E-06	mr1772	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117491108	NA	1.06E-07	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117491108	NA	2.06E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251