\
| Variant ID: vg1117490256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17490256 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGCAAGATACTCAAAATTCTTGTGATTAAATCGTCTCATGAAGGCGCATGATATAATAAGAAAGGGAGGGAAGCGTATACATGGAGAAAAAGAAGAAAG[G/A]
GAAAAATGAAAAATGTGGAGGGGAAGCGTAGGTACCCACGTACGTAGGTGTGTACCGAAGGTGGAGAGGTGGGACATCGTAGTATTTAGTTTGTTCTAAG
CTTAGAACAAACTAAATACTACGATGTCCCACCTCTCCACCTTCGGTACACACCTACGTACGTGGGTACCTACGCTTCCCCTCCACATTTTTCATTTTTC[C/T]
CTTTCTTCTTTTTCTCCATGTATACGCTTCCCTCCCTTTCTTATTATATCATGCGCCTTCATGAGACGATTTAATCACAAGAATTTTGAGTATCTTGCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 0.60% | 5.42% | 3.39% | NA |
| All Indica | 2759 | 84.10% | 0.90% | 9.17% | 5.76% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.20% | 0.07% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 0.50% | 3.19% | 1.01% | NA |
| Indica II | 465 | 92.70% | 0.20% | 5.81% | 1.29% | NA |
| Indica III | 913 | 73.80% | 0.80% | 14.79% | 10.62% | NA |
| Indica Intermediate | 786 | 82.60% | 1.90% | 9.16% | 6.36% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117490256 | G -> A | LOC_Os11g30060.1 | downstream_gene_variant ; 701.0bp to feature; MODIFIER | silent_mutation | Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg1117490256 | G -> A | LOC_Os11g30060-LOC_Os11g30070 | intergenic_region ; MODIFIER | silent_mutation | Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg1117490256 | G -> DEL | N | N | silent_mutation | Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117490256 | NA | 7.80E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | NA | 5.39E-08 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | 3.67E-06 | 2.32E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | 1.35E-06 | 2.47E-07 | mr1265_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | NA | 2.66E-06 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | NA | 2.82E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | NA | 6.99E-06 | mr1782_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117490256 | NA | 4.07E-07 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |