Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117490256:

Variant ID: vg1117490256 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17490256
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCAAGATACTCAAAATTCTTGTGATTAAATCGTCTCATGAAGGCGCATGATATAATAAGAAAGGGAGGGAAGCGTATACATGGAGAAAAAGAAGAAAG[G/A]
GAAAAATGAAAAATGTGGAGGGGAAGCGTAGGTACCCACGTACGTAGGTGTGTACCGAAGGTGGAGAGGTGGGACATCGTAGTATTTAGTTTGTTCTAAG

Reverse complement sequence

CTTAGAACAAACTAAATACTACGATGTCCCACCTCTCCACCTTCGGTACACACCTACGTACGTGGGTACCTACGCTTCCCCTCCACATTTTTCATTTTTC[C/T]
CTTTCTTCTTTTTCTCCATGTATACGCTTCCCTCCCTTTCTTATTATATCATGCGCCTTCATGAGACGATTTAATCACAAGAATTTTGAGTATCTTGCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	0.60%	5.42%	3.39%	NA
All Indica	2759	84.10%	0.90%	9.17%	5.76%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.07%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.30%	0.50%	3.19%	1.01%	NA
Indica II	465	92.70%	0.20%	5.81%	1.29%	NA
Indica III	913	73.80%	0.80%	14.79%	10.62%	NA
Indica Intermediate	786	82.60%	1.90%	9.16%	6.36%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117490256	G -> A	LOC_Os11g30060.1	downstream_gene_variant ; 701.0bp to feature; MODIFIER	silent_mutation	Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg1117490256	G -> A	LOC_Os11g30060-LOC_Os11g30070	intergenic_region ; MODIFIER	silent_mutation	Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg1117490256	G -> DEL	N	N	silent_mutation	Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117490256	NA	7.80E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	NA	5.39E-08	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	3.67E-06	2.32E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	1.35E-06	2.47E-07	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	NA	2.66E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	NA	2.82E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	NA	6.99E-06	mr1782_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256	NA	4.07E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251