\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117490256:

Variant ID: vg1117490256 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17490256
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCAAGATACTCAAAATTCTTGTGATTAAATCGTCTCATGAAGGCGCATGATATAATAAGAAAGGGAGGGAAGCGTATACATGGAGAAAAAGAAGAAAG[G/A]
GAAAAATGAAAAATGTGGAGGGGAAGCGTAGGTACCCACGTACGTAGGTGTGTACCGAAGGTGGAGAGGTGGGACATCGTAGTATTTAGTTTGTTCTAAG

Reverse complement sequence

CTTAGAACAAACTAAATACTACGATGTCCCACCTCTCCACCTTCGGTACACACCTACGTACGTGGGTACCTACGCTTCCCCTCCACATTTTTCATTTTTC[C/T]
CTTTCTTCTTTTTCTCCATGTATACGCTTCCCTCCCTTTCTTATTATATCATGCGCCTTCATGAGACGATTTAATCACAAGAATTTTGAGTATCTTGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 0.60% 5.42% 3.39% NA
All Indica  2759 84.10% 0.90% 9.17% 5.76% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.30% 0.50% 3.19% 1.01% NA
Indica II  465 92.70% 0.20% 5.81% 1.29% NA
Indica III  913 73.80% 0.80% 14.79% 10.62% NA
Indica Intermediate  786 82.60% 1.90% 9.16% 6.36% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117490256 G -> A LOC_Os11g30060.1 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg1117490256 G -> A LOC_Os11g30060-LOC_Os11g30070 intergenic_region ; MODIFIER silent_mutation Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg1117490256 G -> DEL N N silent_mutation Average:51.083; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117490256 NA 7.80E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 NA 5.39E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 3.67E-06 2.32E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 1.35E-06 2.47E-07 mr1265_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 NA 2.66E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 NA 2.82E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 NA 6.99E-06 mr1782_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117490256 NA 4.07E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251