\
| Variant ID: vg1117477925 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17477925 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 112. )
AGAATTAGTCATACATAAAGTACTATTCATGTTTTATCATTTAATAACAACAAATATACTAATCATAACAAATTATGACGGTCAAATGTTACACATAAAC[A/T]
ATACAAAACTACGGTCCTTTTTGGACGGTGGTAGTATATAGCACTCTTCATCAGAGAAAATCTAAAAAGAATGAAACATTCGACCATCGATTTACATTAT
ATAATGTAAATCGATGGTCGAATGTTTCATTCTTTTTAGATTTTCTCTGATGAAGAGTGCTATATACTACCACCGTCCAAAAAGGACCGTAGTTTTGTAT[T/A]
GTTTATGTGTAACATTTGACCGTCATAATTTGTTATGATTAGTATATTTGTTGTTATTAAATGATAAAACATGAATAGTACTTTATGTATGACTAATTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 18.10% | 0.04% | 5.46% | NA |
| All Indica | 2759 | 70.10% | 21.00% | 0.04% | 8.81% | NA |
| All Japonica | 1512 | 99.00% | 0.40% | 0.07% | 0.53% | NA |
| Aus | 269 | 16.40% | 83.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.00% | 13.90% | 0.00% | 6.05% | NA |
| Indica II | 465 | 51.20% | 30.30% | 0.00% | 18.49% | NA |
| Indica III | 913 | 72.80% | 20.80% | 0.00% | 6.35% | NA |
| Indica Intermediate | 786 | 70.70% | 21.10% | 0.13% | 8.02% | NA |
| Temperate Japonica | 767 | 99.10% | 0.10% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 98.80% | 1.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 18.90% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117477925 | A -> T | LOC_Os11g30040.1 | downstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:33.017; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1117477925 | A -> T | LOC_Os11g30050.1 | downstream_gene_variant ; 1519.0bp to feature; MODIFIER | silent_mutation | Average:33.017; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1117477925 | A -> T | LOC_Os11g30040-LOC_Os11g30050 | intergenic_region ; MODIFIER | silent_mutation | Average:33.017; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1117477925 | A -> DEL | N | N | silent_mutation | Average:33.017; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117477925 | NA | 4.66E-06 | mr1045 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.17E-07 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 6.36E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.07E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.42E-07 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 3.27E-06 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 8.05E-06 | mr1285 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 8.96E-06 | mr1297 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.85E-07 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | 1.00E-06 | 1.00E-06 | mr1342 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 3.61E-07 | mr1433 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 3.70E-08 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 8.13E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 3.39E-07 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 5.81E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 9.34E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 2.18E-06 | mr1668 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.20E-07 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 2.00E-07 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.15E-10 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 9.27E-08 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.37E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 4.88E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 8.03E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | 1.04E-06 | 4.91E-11 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 2.60E-08 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 3.71E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 7.31E-06 | mr1788 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 4.17E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 5.42E-06 | mr1928 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 4.55E-06 | mr1931 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 2.67E-06 | mr1943 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 7.35E-09 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 7.57E-08 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 1.68E-06 | mr1958 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 9.70E-08 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 5.30E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117477925 | NA | 3.68E-06 | mr1982 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |