RiceVarMap2

Detailed information for vg1117477788:

Variant ID: vg1117477788 (JBrowse)

Variation Type: SNP

Chromosome: chr11

Position: 17477788

Reference Allele: G

Alternative Allele: C

Primary Allele: G

Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAATATTCTATTAAATATCATATAAATATTTTTAAAATATCTTCTACATATGTCCTATTTTAAATGCATTTTTAAATTTCCGTGTCCAATGCCTGTCT[G/C]
TCCGTCTTATTTAAAAAAATTATAATAAAATTAAAAAGAATTAGTCATACATAAAGTACTATTCATGTTTTATCATTTAATAACAACAAATATACTAATC

Reverse complement sequence

GATTAGTATATTTGTTGTTATTAAATGATAAAACATGAATAGTACTTTATGTATGACTAATTCTTTTTAATTTTATTATAATTTTTTTAAATAAGACGGA[C/G]
AGACAGGCATTGGACACGGAAATTTAAAAATGCATTTAAAATAGGACATATGTAGAAGATATTTTAAAAATATTTATATGATATTTAATAGAATATTTAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.00%	3.70%	4.36%	5.01%	NA
All Indica	2759	90.80%	0.10%	0.87%	8.16%	NA
All Japonica	1512	76.70%	11.00%	11.77%	0.46%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.40%	0.00%	1.85%	5.71%	NA
Indica II	465	81.50%	0.20%	1.29%	16.99%	NA
Indica III	913	93.50%	0.20%	0.33%	5.91%	NA
Indica Intermediate	786	92.00%	0.10%	0.51%	7.38%	NA
Temperate Japonica	767	61.50%	18.00%	19.82%	0.65%	NA
Tropical Japonica	504	97.40%	0.20%	2.18%	0.20%	NA
Japonica Intermediate	241	81.70%	11.60%	6.22%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	2.20%	4.44%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117477788	G -> DEL	N	N	silent_mutation	Average:38.089; most accessible tissue: Callus, score: 60.274	N	N	N	N
vg1117477788	G -> C	LOC_Os11g30040.1	downstream_gene_variant ; 4554.0bp to feature; MODIFIER	silent_mutation	Average:38.089; most accessible tissue: Callus, score: 60.274	N	N	N	N
vg1117477788	G -> C	LOC_Os11g30050.1	downstream_gene_variant ; 1656.0bp to feature; MODIFIER	silent_mutation	Average:38.089; most accessible tissue: Callus, score: 60.274	N	N	N	N
vg1117477788	G -> C	LOC_Os11g30040-LOC_Os11g30050	intergenic_region ; MODIFIER	silent_mutation	Average:38.089; most accessible tissue: Callus, score: 60.274	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117477788	NA	8.41E-06	mr1063	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477788	7.95E-07	7.95E-07	mr1857	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1117477788:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact