Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1117477253:

Variant ID: vg1117477253 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17477253
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGGATCGACGCCGTTCTTGGTCTTCCTCGCCATGACCGAGACCGCCGTCTGCACCACCTTCTCCATCGTTCAAGGAGTGGCCACCACACCACTGCCAC[C/G]
ATCACCATGGCGGGCGCCGGCCTAGGGTTAGTGGCCACCGCCACAACCCTCGGCGCCACATCACCATTGCTGCTACTCCTCCAACCCCCTATAAACGCTC

Reverse complement sequence

GAGCGTTTATAGGGGGTTGGAGGAGTAGCAGCAATGGTGATGTGGCGCCGAGGGTTGTGGCGGTGGCCACTAACCCTAGGCCGGCGCCCGCCATGGTGAT[G/C]
GTGGCAGTGGTGTGGTGGCCACTCCTTGAACGATGGAGAAGGTGGTGCAGACGGCGGTCTCGGTCATGGCGAGGAAGACCAAGAACGGCGTCGATCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.80%	17.70%	1.57%	0.91%	NA
All Indica	2759	75.40%	20.70%	2.46%	1.49%	NA
All Japonica	1512	99.40%	0.40%	0.20%	0.00%	NA
Aus	269	17.80%	82.20%	0.00%	0.00%	NA
Indica I	595	82.90%	13.60%	2.86%	0.67%	NA
Indica II	465	60.60%	29.70%	4.30%	5.38%	NA
Indica III	913	78.20%	20.60%	0.77%	0.44%	NA
Indica Intermediate	786	75.20%	20.70%	3.05%	1.02%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	74.00%	25.00%	1.04%	0.00%	NA
Intermediate	90	76.70%	18.90%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117477253	C -> DEL	N	N	silent_mutation	Average:56.233; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1117477253	C -> G	LOC_Os11g30040.1	downstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:56.233; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1117477253	C -> G	LOC_Os11g30050.1	downstream_gene_variant ; 2191.0bp to feature; MODIFIER	silent_mutation	Average:56.233; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1117477253	C -> G	LOC_Os11g30040-LOC_Os11g30050	intergenic_region ; MODIFIER	silent_mutation	Average:56.233; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117477253	NA	1.94E-07	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	8.39E-06	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	3.97E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	4.63E-07	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	6.05E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	5.41E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	8.56E-06	mr1285	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	4.86E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	1.61E-07	mr1318	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	9.21E-06	9.20E-06	mr1329	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	1.08E-06	1.08E-06	mr1342	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	8.83E-06	mr1371	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	5.12E-06	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	2.92E-07	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	3.28E-06	mr1434	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	2.96E-08	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	2.24E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	4.72E-07	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	4.20E-06	4.20E-06	mr1576	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	9.20E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	8.27E-06	mr1606	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	1.32E-06	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	1.42E-07	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	3.07E-07	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	8.73E-11	mr1693	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	1.31E-07	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	9.05E-06	9.05E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	3.36E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	5.39E-07	1.93E-11	mr1729	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	7.02E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	6.35E-08	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	9.22E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	3.83E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	4.49E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	6.22E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	2.53E-07	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	1.26E-07	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117477253	NA	2.88E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251