Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117476840:

Variant ID: vg1117476840 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17476840
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAATATTTGGGTGATCTCATCCATATATATGGATAGAGTAACAACCAACTCAGGGACACGACGGTTGGTCGTGCCCCACACCTCTTCTCGCCTCACGG[C/T]
GATTCTAGCAACGGACGCGATGGTTCCCAAACCATCGCGCCTCCAGTTGCCGCCTCTCTCCCCCCTGTATATTGTAACTGTTATCAATAAAGAATCCGCT

Reverse complement sequence

AGCGGATTCTTTATTGATAACAGTTACAATATACAGGGGGGAGAGAGGCGGCAACTGGAGGCGCGATGGTTTGGGAACCATCGCGTCCGTTGCTAGAATC[G/A]
CCGTGAGGCGAGAAGAGGTGTGGGGCACGACCAACCGTCGTGTCCCTGAGTTGGTTGTTACTCTATCCATATATATGGATGAGATCACCCAAATATTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	9.00%	1.21%	1.04%	NA
All Indica	2759	81.20%	15.20%	1.88%	1.70%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.90%	4.00%	1.85%	1.18%	NA
Indica II	465	81.50%	8.60%	4.95%	4.95%	NA
Indica III	913	75.00%	23.90%	0.33%	0.77%	NA
Indica Intermediate	786	79.30%	17.60%	1.91%	1.27%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	0.00%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117476840	C -> T	LOC_Os11g30040.1	downstream_gene_variant ; 3606.0bp to feature; MODIFIER	silent_mutation	Average:33.057; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg1117476840	C -> T	LOC_Os11g30050.1	downstream_gene_variant ; 2604.0bp to feature; MODIFIER	silent_mutation	Average:33.057; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg1117476840	C -> T	LOC_Os11g30040-LOC_Os11g30050	intergenic_region ; MODIFIER	silent_mutation	Average:33.057; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg1117476840	C -> DEL	N	N	silent_mutation	Average:33.057; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117476840	NA	1.12E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	2.48E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	4.72E-07	1.16E-07	mr1265_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	9.21E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	2.62E-06	3.50E-07	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	1.25E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	5.97E-08	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	9.27E-06	mr1782_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	9.21E-06	mr1817_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117476840	NA	6.03E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251