\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117469649:

Variant ID: vg1117469649 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17469649
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGGGACATACTAACTAATAGAATCATTTGTGGGTGTGCCAATAGTGAATTAAGTGTTAAATGATGCTATAGGCTGGTCTTTGGGGGCATGGCTATGT[C/T]
GATGTGGGACTGATGTTCCAGGGCATTACATAAGGAAGCCTTGGCAATTATAGTCGACTTTATCCGTTAGAGAGGCATTCATGTCTATTTTTAACGGTGT

Reverse complement sequence

ACACCGTTAAAAATAGACATGAATGCCTCTCTAACGGATAAAGTCGACTATAATTGCCAAGGCTTCCTTATGTAATGCCCTGGAACATCAGTCCCACATC[G/A]
ACATAGCCATGCCCCCAAAGACCAGCCTATAGCATCATTTAACACTTAATTCACTATTGGCACACCCACAAATGATTCTATTAGTTAGTATGTCCCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 11.20% 0.34% 5.84% NA
All Indica  2759 76.90% 17.50% 0.14% 5.44% NA
All Japonica  1512 91.10% 0.50% 0.60% 7.87% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.30% 21.80% 0.17% 3.70% NA
Indica II  465 59.40% 22.40% 0.00% 18.28% NA
Indica III  913 84.90% 14.80% 0.00% 0.33% NA
Indica Intermediate  786 80.00% 14.50% 0.38% 5.09% NA
Temperate Japonica  767 83.10% 0.40% 1.17% 15.38% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 71.10% 17.80% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117469649 C -> T LOC_Os11g30030.1 upstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:43.563; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1117469649 C -> T LOC_Os11g30040.1 upstream_gene_variant ; 2744.0bp to feature; MODIFIER silent_mutation Average:43.563; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1117469649 C -> T LOC_Os11g30020-LOC_Os11g30030 intergenic_region ; MODIFIER silent_mutation Average:43.563; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1117469649 C -> DEL N N silent_mutation Average:43.563; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117469649 5.19E-06 5.19E-06 mr1019 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 3.66E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 2.99E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 3.20E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 7.01E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 1.67E-06 mr1060 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 4.42E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 1.41E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 3.90E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 7.00E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 1.19E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 8.55E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 2.12E-06 2.12E-06 mr1303 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 2.38E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 2.94E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 5.56E-07 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 1.29E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 8.09E-07 mr1483 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 8.24E-06 mr1501 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 4.37E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 7.76E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 2.43E-06 mr1635 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 8.36E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 7.35E-06 mr1757 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 7.54E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 2.01E-06 mr1854 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 3.36E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 4.64E-07 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 1.17E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 4.26E-06 mr1963 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117469649 NA 1.14E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251