\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117465014:

Variant ID: vg1117465014 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17465014
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAATATAAATCGGGGTGAAGTGCGTTGTCCGTCTGCGAAAATAGATTTTCGCAGGCGGACCACTTAAGCGACGCCTGCGAAAATGATTTTCGCAGGC[A/G]
GACCACCCAAACCGCGCCTGCGAAAATCATACCTACCCCAAAAAATTTTAAGTCTTATCTTCTCCTCCACCCCCTCCCCACCACTCATTTCCCTCACTTA

Reverse complement sequence

TAAGTGAGGGAAATGAGTGGTGGGGAGGGGGTGGAGGAGAAGATAAGACTTAAAATTTTTTGGGGTAGGTATGATTTTCGCAGGCGCGGTTTGGGTGGTC[T/C]
GCCTGCGAAAATCATTTTCGCAGGCGTCGCTTAAGTGGTCCGCCTGCGAAAATCTATTTTCGCAGACGGACAACGCACTTCACCCCGATTTATATTTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.60% 46.50% 0.91% 6.03% NA
All Indica  2759 59.60% 33.90% 0.98% 5.55% NA
All Japonica  1512 16.00% 74.90% 0.79% 8.27% NA
Aus  269 95.50% 3.70% 0.74% 0.00% NA
Indica I  595 61.30% 34.10% 0.50% 4.03% NA
Indica II  465 54.00% 24.90% 2.58% 18.49% NA
Indica III  913 59.10% 40.50% 0.00% 0.33% NA
Indica Intermediate  786 62.00% 31.40% 1.53% 5.09% NA
Temperate Japonica  767 2.00% 80.70% 1.17% 16.17% NA
Tropical Japonica  504 38.90% 60.50% 0.60% 0.00% NA
Japonica Intermediate  241 12.90% 86.70% 0.00% 0.41% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 36.70% 53.30% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117465014 A -> DEL N N silent_mutation Average:64.639; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1117465014 A -> G LOC_Os11g30020.1 upstream_gene_variant ; 899.0bp to feature; MODIFIER silent_mutation Average:64.639; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N
vg1117465014 A -> G LOC_Os11g30020-LOC_Os11g30030 intergenic_region ; MODIFIER silent_mutation Average:64.639; most accessible tissue: Minghui63 young leaf, score: 82.907 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117465014 A G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117465014 4.17E-06 1.77E-07 mr1303 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 3.94E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 4.21E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 5.93E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 5.04E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 1.13E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 2.54E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465014 NA 7.06E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251