\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117465001:

Variant ID: vg1117465001 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17465001
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGACCGCCTATAAAAATATAAATCGGGGTGAAGTGCGTTGTCCGTCTGCGAAAATAGATTTTCGCAGGCGGACCACTTAAGCGACGCCTGCGAAAAT[G/C]
ATTTTCGCAGGCAGACCACCCAAACCGCGCCTGCGAAAATCATACCTACCCCAAAAAATTTTAAGTCTTATCTTCTCCTCCACCCCCTCCCCACCACTCA

Reverse complement sequence

TGAGTGGTGGGGAGGGGGTGGAGGAGAAGATAAGACTTAAAATTTTTTGGGGTAGGTATGATTTTCGCAGGCGCGGTTTGGGTGGTCTGCCTGCGAAAAT[C/G]
ATTTTCGCAGGCGTCGCTTAAGTGGTCCGCCTGCGAAAATCTATTTTCGCAGACGGACAACGCACTTCACCCCGATTTATATTTTTATAGGCGGTCATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 10.60% 0.23% 5.95% NA
All Indica  2759 76.90% 17.50% 0.14% 5.44% NA
All Japonica  1512 91.10% 0.30% 0.46% 8.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 73.60% 22.50% 0.17% 3.70% NA
Indica II  465 58.10% 23.20% 0.43% 18.28% NA
Indica III  913 85.40% 14.20% 0.00% 0.33% NA
Indica Intermediate  786 80.50% 14.20% 0.13% 5.09% NA
Temperate Japonica  767 82.90% 0.30% 0.91% 15.91% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 14.40% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117465001 G -> DEL N N silent_mutation Average:62.882; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg1117465001 G -> C LOC_Os11g30020.1 upstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:62.882; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg1117465001 G -> C LOC_Os11g30020-LOC_Os11g30030 intergenic_region ; MODIFIER silent_mutation Average:62.882; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117465001 G C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117465001 2.34E-06 2.34E-06 mr1019 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 8.68E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 3.91E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 3.11E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 4.70E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 7.33E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 7.07E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 8.76E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 4.58E-06 NA mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 1.57E-06 1.57E-06 mr1303 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 7.59E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 2.92E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 4.83E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117465001 NA 4.80E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251