\
| Variant ID: vg1117464587 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17464587 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 123. )
TAAAGTTGTTTTTAAAAAAATCATATTAATCCATTAAAATAGTAAATACTTAATTAATCATAAGAAAATATGTCGTTCCATTTTACGTGCCGAACAACTC[C/T]
GTACACCAATCTGAAGCATAGAACATTGGAGACAAGTCGGAGTAATAAGAGAAGTATATAAGAGGATATGTGGATAAAAGGAGAGAGGAAATAGGTGATT
AATCACCTATTTCCTCTCTCCTTTTATCCACATATCCTCTTATATACTTCTCTTATTACTCCGACTTGTCTCCAATGTTCTATGCTTCAGATTGGTGTAC[G/A]
GAGTTGTTCGGCACGTAAAATGGAACGACATATTTTCTTATGATTAATTAAGTATTTACTATTTTAATGGATTAATATGATTTTTTTAAAAACAACTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 10.50% | 0.15% | 2.48% | NA |
| All Indica | 2759 | 82.60% | 17.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 91.70% | 0.40% | 0.33% | 7.61% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.50% | 22.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 13.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.10% | 0.30% | 0.65% | 14.99% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117464587 | C -> T | LOC_Os11g30020.1 | upstream_gene_variant ; 472.0bp to feature; MODIFIER | silent_mutation | Average:44.294; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1117464587 | C -> T | LOC_Os11g30020-LOC_Os11g30030 | intergenic_region ; MODIFIER | silent_mutation | Average:44.294; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1117464587 | C -> DEL | N | N | silent_mutation | Average:44.294; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117464587 | 2.65E-06 | 2.65E-06 | mr1019 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 9.57E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 4.54E-08 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 3.23E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 4.65E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 6.68E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | 2.29E-06 | NA | mr1303 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | 6.81E-07 | 6.80E-07 | mr1303 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 6.36E-06 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 2.96E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 9.86E-06 | mr1854 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 5.10E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117464587 | NA | 4.21E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |