\
| Variant ID: vg1117421514 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17421514 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )
GTTTACCTCTAATCGAGTAATGTATATTCCTCGCAAAAAATAAAGAAGAACCATTGCGTCAAATACCAATGGATGGTTCAAGTATGGCCGAGTTTAGTTC[T/C]
AAACTTTTTCTTCAAACTTTTAACTTTTTTATCACATTAAAACTTTTCTACACACATAAACTTTCAACTTTTTCATCACATCGTTCCAATTTCAACCAAA
TTTGGTTGAAATTGGAACGATGTGATGAAAAAGTTGAAAGTTTATGTGTGTAGAAAAGTTTTAATGTGATAAAAAAGTTAAAAGTTTGAAGAAAAAGTTT[A/G]
GAACTAAACTCGGCCATACTTGAACCATCCATTGGTATTTGACGCAATGGTTCTTCTTTATTTTTTGCGAGGAATATACATTACTCGATTAGAGGTAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 19.70% | 1.71% | 5.01% | NA |
| All Indica | 2759 | 83.00% | 6.90% | 2.25% | 7.87% | NA |
| All Japonica | 1512 | 53.50% | 45.00% | 0.60% | 0.93% | NA |
| Aus | 269 | 92.90% | 5.60% | 1.49% | 0.00% | NA |
| Indica I | 595 | 82.20% | 11.80% | 1.51% | 4.54% | NA |
| Indica II | 465 | 70.10% | 8.20% | 1.51% | 20.22% | NA |
| Indica III | 913 | 89.80% | 2.80% | 3.50% | 3.83% | NA |
| Indica Intermediate | 786 | 83.50% | 7.00% | 1.78% | 7.76% | NA |
| Temperate Japonica | 767 | 34.60% | 64.70% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 73.20% | 24.00% | 1.59% | 1.19% | NA |
| Japonica Intermediate | 241 | 72.60% | 26.10% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 66.70% | 32.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 18.90% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117421514 | T -> DEL | N | N | silent_mutation | Average:65.693; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1117421514 | T -> C | LOC_Os11g29970.1 | upstream_gene_variant ; 4033.0bp to feature; MODIFIER | silent_mutation | Average:65.693; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1117421514 | T -> C | LOC_Os11g29980.1 | downstream_gene_variant ; 4031.0bp to feature; MODIFIER | silent_mutation | Average:65.693; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1117421514 | T -> C | LOC_Os11g29970-LOC_Os11g29980 | intergenic_region ; MODIFIER | silent_mutation | Average:65.693; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117421514 | NA | 2.00E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1117421514 | NA | 2.20E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117421514 | NA | 3.47E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117421514 | 3.01E-06 | NA | mr1973 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117421514 | NA | 2.73E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117421514 | NA | 8.05E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |