\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117420010:

Variant ID: vg1117420010 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17420010
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTTACTCATTGCCCCAGTCATGCTCGCCATCACTGTTAATCCTTTACACTTATACACGTGCCTATAGCTACATCGTTCGGTTGTCAAACAGTTAT[C/G]
AAAAGAACTAGCTAATCTTCCCTTTTCCATAAAAGAAAAAATATCAAACGGCTTTCATCTTAACTGATCCTTTTCTGATGGTTCTAACATTGATCATAGG

Reverse complement sequence

CCTATGATCAATGTTAGAACCATCAGAAAAGGATCAGTTAAGATGAAAGCCGTTTGATATTTTTTCTTTTATGGAAAAGGGAAGATTAGCTAGTTCTTTT[G/C]
ATAACTGTTTGACAACCGAACGATGTAGCTATAGGCACGTGTATAAGTGTAAAGGATTAACAGTGATGGCGAGCATGACTGGGGCAATGAGTAAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 16.50% 0.13% 3.17% NA
All Indica  2759 92.70% 2.10% 0.11% 5.11% NA
All Japonica  1512 53.80% 45.70% 0.07% 0.46% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 88.90% 7.20% 0.17% 3.70% NA
Indica II  465 82.20% 0.00% 0.00% 17.85% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 1.80% 0.25% 4.58% NA
Temperate Japonica  767 65.70% 33.50% 0.00% 0.78% NA
Tropical Japonica  504 46.20% 53.60% 0.20% 0.00% NA
Japonica Intermediate  241 31.50% 68.00% 0.00% 0.41% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 80.00% 15.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117420010 C -> DEL N N silent_mutation Average:71.263; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N
vg1117420010 C -> G LOC_Os11g29970.1 upstream_gene_variant ; 2529.0bp to feature; MODIFIER silent_mutation Average:71.263; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N
vg1117420010 C -> G LOC_Os11g29970-LOC_Os11g29980 intergenic_region ; MODIFIER silent_mutation Average:71.263; most accessible tissue: Minghui63 flag leaf, score: 86.911 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117420010 C G 0.01 0.02 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117420010 NA 4.60E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117420010 NA 1.83E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 9.94E-12 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 4.24E-06 NA mr1135 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 9.63E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 5.10E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 1.30E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 9.37E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 1.80E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 4.93E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 1.63E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 2.33E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 5.04E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117420010 NA 1.22E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251