\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117300240:

Variant ID: vg1117300240 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17300240
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTTATGTAGGCATATAATTTTACATATTTCACAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAACGGTGTCAAACATTTT[G/A]
AAACGGAGCGAGTATATTTGATAGTCTTCTTTGGACTAGTCCTCCCAATTTTAGATAGGCATACATTCTTGGTCATATGCCCTCGTCAAAGTTGGTAAAT

Reverse complement sequence

ATTTACCAACTTTGACGAGGGCATATGACCAAGAATGTATGCCTATCTAAAATTGGGAGGACTAGTCCAAAGAAGACTATCAAATATACTCGCTCCGTTT[C/T]
AAAATGTTTGACACCGTTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATATGCCTACATAAAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 5.70% 0.17% 39.80% NA
All Indica  2759 26.30% 6.90% 0.29% 66.47% NA
All Japonica  1512 94.60% 4.30% 0.00% 1.06% NA
Aus  269 96.70% 0.70% 0.00% 2.60% NA
Indica I  595 22.00% 16.30% 0.34% 61.34% NA
Indica II  465 37.40% 0.00% 0.22% 62.37% NA
Indica III  913 17.90% 4.80% 0.22% 77.11% NA
Indica Intermediate  786 32.80% 6.40% 0.38% 60.43% NA
Temperate Japonica  767 99.00% 0.10% 0.00% 0.91% NA
Tropical Japonica  504 86.90% 11.90% 0.00% 1.19% NA
Japonica Intermediate  241 97.10% 1.70% 0.00% 1.24% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 64.40% 11.10% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117300240 G -> A LOC_Os11g29800.1 upstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:82.621; most accessible tissue: Minghui63 flower, score: 93.982 N N N N
vg1117300240 G -> A LOC_Os11g29810.1 downstream_gene_variant ; 705.0bp to feature; MODIFIER silent_mutation Average:82.621; most accessible tissue: Minghui63 flower, score: 93.982 N N N N
vg1117300240 G -> A LOC_Os11g29810-LOC_Os11g29820 intergenic_region ; MODIFIER silent_mutation Average:82.621; most accessible tissue: Minghui63 flower, score: 93.982 N N N N
vg1117300240 G -> DEL N N silent_mutation Average:82.621; most accessible tissue: Minghui63 flower, score: 93.982 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117300240 G A -0.03 -0.02 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117300240 NA 9.33E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 7.17E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 4.72E-06 NA mr1380 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 2.95E-06 NA mr1380 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 7.71E-06 NA mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 6.58E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 7.66E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 3.57E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 8.15E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 9.30E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 1.53E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 1.93E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 4.96E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 5.55E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 1.02E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117300240 NA 2.04E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251