\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117256238:

Variant ID: vg1117256238 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17256238
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTATTTTAATCCTAGATGCCAAATTTGAGTATAAACACCCAGAATGAGAAATTTGCATATCTGTCATCCTTAAAGATCGGCTTCGCTTGAATGCTATC[A/G]
TTAAAATAGGATTCAATCGAAGGTCACTTTCAAGCTGTGGGAGCTGTAATGCCATTTTCACTCTTTTTTGCATTTGTAAATTATTTTTCGTCCAATACAT

Reverse complement sequence

ATGTATTGGACGAAAAATAATTTACAAATGCAAAAAAGAGTGAAAATGGCATTACAGCTCCCACAGCTTGAAAGTGACCTTCGATTGAATCCTATTTTAA[T/C]
GATAGCATTCAAGCGAAGCCGATCTTTAAGGATGACAGATATGCAAATTTCTCATTCTGGGTGTTTATACTCAAATTTGGCATCTAGGATTAAAATAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 2.50% 0.76% 45.18% NA
All Indica  2759 45.90% 3.90% 0.62% 49.58% NA
All Japonica  1512 57.90% 0.20% 1.06% 40.81% NA
Aus  269 87.00% 0.00% 0.37% 12.64% NA
Indica I  595 23.90% 12.60% 1.18% 62.35% NA
Indica II  465 52.50% 0.00% 1.08% 46.45% NA
Indica III  913 52.90% 1.00% 0.22% 45.89% NA
Indica Intermediate  786 50.60% 2.90% 0.38% 46.06% NA
Temperate Japonica  767 85.30% 0.30% 0.13% 14.34% NA
Tropical Japonica  504 31.70% 0.00% 1.79% 66.47% NA
Japonica Intermediate  241 25.70% 0.40% 2.49% 71.37% NA
VI/Aromatic  96 14.60% 0.00% 0.00% 85.42% NA
Intermediate  90 53.30% 6.70% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117256238 A -> DEL N N silent_mutation Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1117256238 A -> G LOC_Os11g29740.1 upstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1117256238 A -> G LOC_Os11g29750.1 upstream_gene_variant ; 3689.0bp to feature; MODIFIER silent_mutation Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1117256238 A -> G LOC_Os11g29740-LOC_Os11g29750 intergenic_region ; MODIFIER silent_mutation Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117256238 NA 2.87E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117256238 NA 6.40E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117256238 2.90E-06 NA mr1625 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117256238 NA 3.68E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117256238 NA 6.94E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117256238 NA 6.01E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251