\
| Variant ID: vg1117256238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17256238 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCTATTTTAATCCTAGATGCCAAATTTGAGTATAAACACCCAGAATGAGAAATTTGCATATCTGTCATCCTTAAAGATCGGCTTCGCTTGAATGCTATC[A/G]
TTAAAATAGGATTCAATCGAAGGTCACTTTCAAGCTGTGGGAGCTGTAATGCCATTTTCACTCTTTTTTGCATTTGTAAATTATTTTTCGTCCAATACAT
ATGTATTGGACGAAAAATAATTTACAAATGCAAAAAAGAGTGAAAATGGCATTACAGCTCCCACAGCTTGAAAGTGACCTTCGATTGAATCCTATTTTAA[T/C]
GATAGCATTCAAGCGAAGCCGATCTTTAAGGATGACAGATATGCAAATTTCTCATTCTGGGTGTTTATACTCAAATTTGGCATCTAGGATTAAAATAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 2.50% | 0.76% | 45.18% | NA |
| All Indica | 2759 | 45.90% | 3.90% | 0.62% | 49.58% | NA |
| All Japonica | 1512 | 57.90% | 0.20% | 1.06% | 40.81% | NA |
| Aus | 269 | 87.00% | 0.00% | 0.37% | 12.64% | NA |
| Indica I | 595 | 23.90% | 12.60% | 1.18% | 62.35% | NA |
| Indica II | 465 | 52.50% | 0.00% | 1.08% | 46.45% | NA |
| Indica III | 913 | 52.90% | 1.00% | 0.22% | 45.89% | NA |
| Indica Intermediate | 786 | 50.60% | 2.90% | 0.38% | 46.06% | NA |
| Temperate Japonica | 767 | 85.30% | 0.30% | 0.13% | 14.34% | NA |
| Tropical Japonica | 504 | 31.70% | 0.00% | 1.79% | 66.47% | NA |
| Japonica Intermediate | 241 | 25.70% | 0.40% | 2.49% | 71.37% | NA |
| VI/Aromatic | 96 | 14.60% | 0.00% | 0.00% | 85.42% | NA |
| Intermediate | 90 | 53.30% | 6.70% | 2.22% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117256238 | A -> DEL | N | N | silent_mutation | Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1117256238 | A -> G | LOC_Os11g29740.1 | upstream_gene_variant ; 3650.0bp to feature; MODIFIER | silent_mutation | Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1117256238 | A -> G | LOC_Os11g29750.1 | upstream_gene_variant ; 3689.0bp to feature; MODIFIER | silent_mutation | Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg1117256238 | A -> G | LOC_Os11g29740-LOC_Os11g29750 | intergenic_region ; MODIFIER | silent_mutation | Average:37.465; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117256238 | NA | 2.87E-06 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117256238 | NA | 6.40E-06 | mr1564 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117256238 | 2.90E-06 | NA | mr1625 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117256238 | NA | 3.68E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117256238 | NA | 6.94E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117256238 | NA | 6.01E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |