\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117255997:

Variant ID: vg1117255997 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17255997
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCCTTGTCCCTTATATAGGGGTTGATCTTGCCATCTACAGGCCCTCCTCTACATCTAACTCGGGATAGAAACAAAAGGAAACCCGAAACATGTCTTCC[C/T]
AAGCAAGGAAAACTCGAAACCCGACAAAACAGACTCGGACACGGACTCTGCCAGTCAGACCGGCCACACACTGCCGGTCTAACCGGCCTACTGGCGGTGG

Reverse complement sequence

CCACCGCCAGTAGGCCGGTTAGACCGGCAGTGTGTGGCCGGTCTGACTGGCAGAGTCCGTGTCCGAGTCTGTTTTGTCGGGTTTCGAGTTTTCCTTGCTT[G/A]
GGAAGACATGTTTCGGGTTTCCTTTTGTTTCTATCCCGAGTTAGATGTAGAGGAGGGCCTGTAGATGGCAAGATCAACCCCTATATAAGGGACAAGGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.70% 25.50% 0.68% 46.13% NA
All Indica  2759 39.10% 10.00% 0.58% 50.34% NA
All Japonica  1512 11.80% 45.30% 0.93% 41.93% NA
Aus  269 3.70% 83.30% 0.37% 12.64% NA
Indica I  595 31.60% 4.40% 0.50% 63.53% NA
Indica II  465 35.10% 16.60% 0.65% 47.74% NA
Indica III  913 46.70% 6.60% 0.11% 46.66% NA
Indica Intermediate  786 38.30% 14.40% 1.15% 46.18% NA
Temperate Japonica  767 1.80% 83.30% 0.13% 14.73% NA
Tropical Japonica  504 28.00% 2.20% 1.39% 68.45% NA
Japonica Intermediate  241 10.00% 14.50% 2.49% 73.03% NA
VI/Aromatic  96 3.10% 5.20% 1.04% 90.62% NA
Intermediate  90 41.10% 18.90% 0.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117255997 C -> T LOC_Os11g29740.1 upstream_gene_variant ; 3409.0bp to feature; MODIFIER silent_mutation Average:28.73; most accessible tissue: Callus, score: 56.722 N N N N
vg1117255997 C -> T LOC_Os11g29750.1 upstream_gene_variant ; 3930.0bp to feature; MODIFIER silent_mutation Average:28.73; most accessible tissue: Callus, score: 56.722 N N N N
vg1117255997 C -> T LOC_Os11g29740-LOC_Os11g29750 intergenic_region ; MODIFIER silent_mutation Average:28.73; most accessible tissue: Callus, score: 56.722 N N N N
vg1117255997 C -> DEL N N silent_mutation Average:28.73; most accessible tissue: Callus, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117255997 NA 6.65E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 3.36E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 2.01E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 1.79E-06 8.59E-10 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 2.41E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 1.38E-09 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 6.81E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 7.36E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 4.90E-08 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 5.66E-09 mr1908 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 9.48E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 1.04E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997 NA 4.77E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251