\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117250681:

Variant ID: vg1117250681 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17250681
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTGCTGCAGTTATTTTTTTTTAGGAAAAACATCAGAAGAGGACAGGGAGAGCCTGTTTTCATTAAAGAAGAAGAGACTTGGCCCCGTTTTTAAGGG[G/A]
AAACCGGGCCCAAAAACCTCACATAAGCACGGTTTGAGGGGGAAACAAAGAAAAAAAACTTGCGACGGCACCACTGGAGGAAAACATAGGTCATCGTTGC

Reverse complement sequence

GCAACGATGACCTATGTTTTCCTCCAGTGGTGCCGTCGCAAGTTTTTTTTCTTTGTTTCCCCCTCAAACCGTGCTTATGTGAGGTTTTTGGGCCCGGTTT[C/T]
CCCTTAAAAACGGGGCCAAGTCTCTTCTTCTTTAATGAAAACAGGCTCTCCCTGTCCTCTTCTGATGTTTTTCCTAAAAAAAAATAACTGCAGCAAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.90% 25.80% 0.49% 44.79% NA
All Indica  2759 14.90% 36.50% 0.65% 47.95% NA
All Japonica  1512 46.50% 11.00% 0.20% 42.26% NA
Aus  269 82.90% 3.70% 0.37% 13.01% NA
Indica I  595 7.90% 28.60% 0.84% 62.69% NA
Indica II  465 31.20% 20.90% 0.43% 47.53% NA
Indica III  913 6.40% 51.90% 0.55% 41.18% NA
Indica Intermediate  786 20.40% 34.00% 0.76% 44.91% NA
Temperate Japonica  767 84.60% 0.80% 0.00% 14.60% NA
Tropical Japonica  504 3.40% 27.60% 0.60% 68.45% NA
Japonica Intermediate  241 15.40% 9.10% 0.00% 75.52% NA
VI/Aromatic  96 7.30% 4.20% 0.00% 88.54% NA
Intermediate  90 26.70% 33.30% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117250681 G -> A LOC_Os11g29730.1 upstream_gene_variant ; 1640.0bp to feature; MODIFIER silent_mutation Average:51.549; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg1117250681 G -> A LOC_Os11g29740.1 downstream_gene_variant ; 1389.0bp to feature; MODIFIER silent_mutation Average:51.549; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg1117250681 G -> A LOC_Os11g29730-LOC_Os11g29740 intergenic_region ; MODIFIER silent_mutation Average:51.549; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg1117250681 G -> DEL N N silent_mutation Average:51.549; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117250681 NA 9.74E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 2.26E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 4.19E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 1.39E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 6.78E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 7.31E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 4.89E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 2.61E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 8.96E-07 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 2.31E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 3.74E-06 1.56E-06 mr1031_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 3.51E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 1.82E-06 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 4.25E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 1.39E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 4.12E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117250681 NA 2.63E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251