\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117249110:

Variant ID: vg1117249110 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17249110
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACATACTCCCATTGTTTTATCCACGTCATCATGAGTTAAAATTTAACTCCCAGTAAAATTTTAACTCATGAGTGAATCTGCGAGTTAAATTTTAACT[C/T]
ATAGTGACGTGGACGAATCTCGAACGTCTATTTCTCGATCCAACGATAGTTTTTAAGTTTCCACTACATATGCGTGGTTTACCATACATATTTTCCCAGT

Reverse complement sequence

ACTGGGAAAATATGTATGGTAAACCACGCATATGTAGTGGAAACTTAAAAACTATCGTTGGATCGAGAAATAGACGTTCGAGATTCGTCCACGTCACTAT[G/A]
AGTTAAAATTTAACTCGCAGATTCACTCATGAGTTAAAATTTTACTGGGAGTTAAATTTTAACTCATGATGACGTGGATAAAACAATGGGAGTATGTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 13.40% 0.93% 43.40% NA
All Indica  2759 37.20% 15.70% 1.27% 45.85% NA
All Japonica  1512 57.70% 0.10% 0.46% 41.80% NA
Aus  269 19.00% 68.00% 0.37% 12.64% NA
Indica I  595 33.40% 6.10% 2.18% 58.32% NA
Indica II  465 34.20% 18.50% 1.08% 46.24% NA
Indica III  913 40.90% 18.50% 0.88% 39.76% NA
Indica Intermediate  786 37.50% 18.10% 1.15% 43.26% NA
Temperate Japonica  767 85.30% 0.00% 0.00% 14.73% NA
Tropical Japonica  504 31.30% 0.00% 0.60% 68.06% NA
Japonica Intermediate  241 24.90% 0.40% 1.66% 73.03% NA
VI/Aromatic  96 4.20% 5.20% 0.00% 90.62% NA
Intermediate  90 50.00% 12.20% 1.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117249110 C -> T LOC_Os11g29730.1 upstream_gene_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:38.483; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg1117249110 C -> T LOC_Os11g29740.1 downstream_gene_variant ; 2960.0bp to feature; MODIFIER silent_mutation Average:38.483; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg1117249110 C -> T LOC_Os11g29730-LOC_Os11g29740 intergenic_region ; MODIFIER silent_mutation Average:38.483; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg1117249110 C -> DEL N N silent_mutation Average:38.483; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117249110 NA 9.32E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 6.24E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 3.93E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 8.38E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.02E-06 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 4.79E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 5.46E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 4.13E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.62E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 2.14E-08 mr1438 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.40E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.47E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.47E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.45E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 9.05E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 1.70E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 3.52E-08 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117249110 NA 3.61E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251