\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117244183:

Variant ID: vg1117244183 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 17244183
Reference Allele: GAlternative Allele: C,GT,GTGT
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAGAAATAAGAAGAGGATTACCGACACACTCTACTCTCTCCCTAATTCTAGTATACAATAAAATACAATAGAGCCTCTTATAATTCAGTTCAAGCTTT[G/C,GT,GTGT]
GTGTGTGTGTGTGAGAGAGAGAGAATGAGAGATGAGAGGGGTATTGATAGGTGGAGAAGTGCCTTGGGAGTGTGGAGATGCTAAGCATCCAAACAACATC

Reverse complement sequence

GATGTTGTTTGGATGCTTAGCATCTCCACACTCCCAAGGCACTTCTCCACCTATCAATACCCCTCTCATCTCTCATTCTCTCTCTCTCACACACACACAC[C/G,AC,ACAC]
AAAGCTTGAACTGAATTATAAGAGGCTCTATTGTATTTTATTGTATACTAGAATTAGGGAGAGAGTAGAGTGTGTCGGTAATCCTCTTCTTATTTCTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 15.90% 0.78% 43.80% GT: 1.14%; GTGT: 0.04%
All Indica  2759 51.00% 1.50% 0.47% 47.01% NA
All Japonica  1512 8.30% 46.00% 1.39% 40.61% GT: 3.51%; GTGT: 0.13%
Aus  269 84.80% 1.90% 0.37% 13.01% NA
Indica I  595 36.80% 2.20% 0.67% 60.34% NA
Indica II  465 51.60% 1.10% 0.65% 46.67% NA
Indica III  913 58.90% 1.00% 0.00% 40.09% NA
Indica Intermediate  786 52.30% 1.80% 0.76% 45.17% NA
Temperate Japonica  767 2.00% 83.70% 0.52% 13.82% NA
Tropical Japonica  504 17.90% 2.20% 2.38% 67.06% GT: 10.12%; GTGT: 0.40%
Japonica Intermediate  241 8.70% 17.80% 2.07% 70.54% GT: 0.83%
VI/Aromatic  96 7.30% 0.00% 1.04% 91.67% NA
Intermediate  90 47.80% 10.00% 1.11% 40.00% GT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117244183 G -> DEL N N silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N
vg1117244183 G -> GT LOC_Os11g29730.1 downstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N
vg1117244183 G -> GT LOC_Os11g29720-LOC_Os11g29730 intergenic_region ; MODIFIER silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N
vg1117244183 G -> GTGT LOC_Os11g29730.1 downstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N
vg1117244183 G -> GTGT LOC_Os11g29720-LOC_Os11g29730 intergenic_region ; MODIFIER silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N
vg1117244183 G -> C LOC_Os11g29730.1 downstream_gene_variant ; 989.0bp to feature; MODIFIER silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N
vg1117244183 G -> C LOC_Os11g29720-LOC_Os11g29730 intergenic_region ; MODIFIER silent_mutation Average:35.522; most accessible tissue: Callus, score: 71.129 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117244183 3.70E-09 5.32E-15 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183 9.36E-07 9.00E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183 3.40E-11 6.19E-18 mr1389 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183 4.61E-08 6.56E-16 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183 1.37E-07 3.56E-15 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251