\
| Variant ID: vg1117244183 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 17244183 |
| Reference Allele: G | Alternative Allele: C,GT,GTGT |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 85. )
AGAAGAAATAAGAAGAGGATTACCGACACACTCTACTCTCTCCCTAATTCTAGTATACAATAAAATACAATAGAGCCTCTTATAATTCAGTTCAAGCTTT[G/C,GT,GTGT]
GTGTGTGTGTGTGAGAGAGAGAGAATGAGAGATGAGAGGGGTATTGATAGGTGGAGAAGTGCCTTGGGAGTGTGGAGATGCTAAGCATCCAAACAACATC
GATGTTGTTTGGATGCTTAGCATCTCCACACTCCCAAGGCACTTCTCCACCTATCAATACCCCTCTCATCTCTCATTCTCTCTCTCTCACACACACACAC[C/G,AC,ACAC]
AAAGCTTGAACTGAATTATAAGAGGCTCTATTGTATTTTATTGTATACTAGAATTAGGGAGAGAGTAGAGTGTGTCGGTAATCCTCTTCTTATTTCTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 15.90% | 0.78% | 43.80% | GT: 1.14%; GTGT: 0.04% |
| All Indica | 2759 | 51.00% | 1.50% | 0.47% | 47.01% | NA |
| All Japonica | 1512 | 8.30% | 46.00% | 1.39% | 40.61% | GT: 3.51%; GTGT: 0.13% |
| Aus | 269 | 84.80% | 1.90% | 0.37% | 13.01% | NA |
| Indica I | 595 | 36.80% | 2.20% | 0.67% | 60.34% | NA |
| Indica II | 465 | 51.60% | 1.10% | 0.65% | 46.67% | NA |
| Indica III | 913 | 58.90% | 1.00% | 0.00% | 40.09% | NA |
| Indica Intermediate | 786 | 52.30% | 1.80% | 0.76% | 45.17% | NA |
| Temperate Japonica | 767 | 2.00% | 83.70% | 0.52% | 13.82% | NA |
| Tropical Japonica | 504 | 17.90% | 2.20% | 2.38% | 67.06% | GT: 10.12%; GTGT: 0.40% |
| Japonica Intermediate | 241 | 8.70% | 17.80% | 2.07% | 70.54% | GT: 0.83% |
| VI/Aromatic | 96 | 7.30% | 0.00% | 1.04% | 91.67% | NA |
| Intermediate | 90 | 47.80% | 10.00% | 1.11% | 40.00% | GT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117244183 | G -> DEL | N | N | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| vg1117244183 | G -> GT | LOC_Os11g29730.1 | downstream_gene_variant ; 988.0bp to feature; MODIFIER | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| vg1117244183 | G -> GT | LOC_Os11g29720-LOC_Os11g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| vg1117244183 | G -> GTGT | LOC_Os11g29730.1 | downstream_gene_variant ; 988.0bp to feature; MODIFIER | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| vg1117244183 | G -> GTGT | LOC_Os11g29720-LOC_Os11g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| vg1117244183 | G -> C | LOC_Os11g29730.1 | downstream_gene_variant ; 989.0bp to feature; MODIFIER | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| vg1117244183 | G -> C | LOC_Os11g29720-LOC_Os11g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:35.522; most accessible tissue: Callus, score: 71.129 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117244183 | 3.70E-09 | 5.32E-15 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117244183 | 9.36E-07 | 9.00E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117244183 | 3.40E-11 | 6.19E-18 | mr1389 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117244183 | 4.61E-08 | 6.56E-16 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117244183 | 1.37E-07 | 3.56E-15 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |