\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117240580:

Variant ID: vg1117240580 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17240580
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGTCTTCTTGATGAAGTCAGATCAACTAAAGGAAGCTTATCTAGAAGAGTCCGAGTTCAAGGAGGATGTGGCATGGTAGTTTATCTATTAATTAGGC[A/G]
GTATTTGTTAGTTTCCTTTTATCTTTAGGAAAGTACGTTTAGTGTCTGATAAGGACTATGTTTTCCTTTTATCTTTAGGAAAGTTTCTTTCTTGTCCGAC

Reverse complement sequence

GTCGGACAAGAAAGAAACTTTCCTAAAGATAAAAGGAAAACATAGTCCTTATCAGACACTAAACGTACTTTCCTAAAGATAAAAGGAAACTAACAAATAC[T/C]
GCCTAATTAATAGATAAACTACCATGCCACATCCTCCTTGAACTCGGACTCTTCTAGATAAGCTTCCTTTAGTTGATCTGACTTCATCAAGAAGACAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 14.50% 1.31% 42.11% NA
All Indica  2759 31.80% 21.90% 1.34% 44.94% NA
All Japonica  1512 54.50% 4.40% 1.32% 39.81% NA
Aus  269 87.00% 0.70% 0.37% 11.90% NA
Indica I  595 31.60% 8.90% 1.68% 57.82% NA
Indica II  465 38.70% 14.80% 0.65% 45.81% NA
Indica III  913 26.10% 34.70% 1.20% 38.01% NA
Indica Intermediate  786 34.60% 21.00% 1.65% 42.75% NA
Temperate Japonica  767 85.70% 0.00% 0.65% 13.69% NA
Tropical Japonica  504 20.40% 12.50% 2.38% 64.68% NA
Japonica Intermediate  241 26.60% 1.20% 1.24% 70.95% NA
VI/Aromatic  96 7.30% 3.10% 2.08% 87.50% NA
Intermediate  90 50.00% 12.20% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117240580 A -> DEL N N silent_mutation Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1117240580 A -> G LOC_Os11g29720.1 upstream_gene_variant ; 2402.0bp to feature; MODIFIER silent_mutation Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1117240580 A -> G LOC_Os11g29730.1 downstream_gene_variant ; 4592.0bp to feature; MODIFIER silent_mutation Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1117240580 A -> G LOC_Os11g29720-LOC_Os11g29730 intergenic_region ; MODIFIER silent_mutation Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117240580 NA 1.21E-07 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 3.19E-06 3.19E-06 mr1230 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 3.41E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 1.22E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 5.54E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 4.35E-07 mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 3.68E-06 3.68E-06 mr1428 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 3.81E-07 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 9.17E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 9.17E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 2.32E-06 2.32E-06 mr1996 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117240580 NA 3.46E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251