\
| Variant ID: vg1117240580 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17240580 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 195. )
AATTGTCTTCTTGATGAAGTCAGATCAACTAAAGGAAGCTTATCTAGAAGAGTCCGAGTTCAAGGAGGATGTGGCATGGTAGTTTATCTATTAATTAGGC[A/G]
GTATTTGTTAGTTTCCTTTTATCTTTAGGAAAGTACGTTTAGTGTCTGATAAGGACTATGTTTTCCTTTTATCTTTAGGAAAGTTTCTTTCTTGTCCGAC
GTCGGACAAGAAAGAAACTTTCCTAAAGATAAAAGGAAAACATAGTCCTTATCAGACACTAAACGTACTTTCCTAAAGATAAAAGGAAACTAACAAATAC[T/C]
GCCTAATTAATAGATAAACTACCATGCCACATCCTCCTTGAACTCGGACTCTTCTAGATAAGCTTCCTTTAGTTGATCTGACTTCATCAAGAAGACAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.10% | 14.50% | 1.31% | 42.11% | NA |
| All Indica | 2759 | 31.80% | 21.90% | 1.34% | 44.94% | NA |
| All Japonica | 1512 | 54.50% | 4.40% | 1.32% | 39.81% | NA |
| Aus | 269 | 87.00% | 0.70% | 0.37% | 11.90% | NA |
| Indica I | 595 | 31.60% | 8.90% | 1.68% | 57.82% | NA |
| Indica II | 465 | 38.70% | 14.80% | 0.65% | 45.81% | NA |
| Indica III | 913 | 26.10% | 34.70% | 1.20% | 38.01% | NA |
| Indica Intermediate | 786 | 34.60% | 21.00% | 1.65% | 42.75% | NA |
| Temperate Japonica | 767 | 85.70% | 0.00% | 0.65% | 13.69% | NA |
| Tropical Japonica | 504 | 20.40% | 12.50% | 2.38% | 64.68% | NA |
| Japonica Intermediate | 241 | 26.60% | 1.20% | 1.24% | 70.95% | NA |
| VI/Aromatic | 96 | 7.30% | 3.10% | 2.08% | 87.50% | NA |
| Intermediate | 90 | 50.00% | 12.20% | 2.22% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117240580 | A -> DEL | N | N | silent_mutation | Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1117240580 | A -> G | LOC_Os11g29720.1 | upstream_gene_variant ; 2402.0bp to feature; MODIFIER | silent_mutation | Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1117240580 | A -> G | LOC_Os11g29730.1 | downstream_gene_variant ; 4592.0bp to feature; MODIFIER | silent_mutation | Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1117240580 | A -> G | LOC_Os11g29720-LOC_Os11g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:28.342; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117240580 | NA | 1.21E-07 | mr1115 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | 3.19E-06 | 3.19E-06 | mr1230 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 3.41E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 1.22E-07 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 5.54E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 4.35E-07 | mr1428 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | 3.68E-06 | 3.68E-06 | mr1428 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 3.81E-07 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 9.17E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 9.17E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | 2.32E-06 | 2.32E-06 | mr1996 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117240580 | NA | 3.46E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |