\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117213282:

Variant ID: vg1117213282 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17213282
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCCAAAGTACTGACAAATAATCAGACCATATAGTGCAGCTCCCTACTGCATGAAGTATTATAAACTAAAGCTCTAGATGACATGGCCAAATTTACTGC[A/C]
GGCGACAAGCTCTGCTATTAAACCTGCTCAAATAAGTCTAGCCTATTATTAAACCTTAGAGCGCAAAACTTTGTGTCGCCATTGTCTCTAAAGTTCGACA

Reverse complement sequence

TGTCGAACTTTAGAGACAATGGCGACACAAAGTTTTGCGCTCTAAGGTTTAATAATAGGCTAGACTTATTTGAGCAGGTTTAATAGCAGAGCTTGTCGCC[T/G]
GCAGTAAATTTGGCCATGTCATCTAGAGCTTTAGTTTATAATACTTCATGCAGTAGGGAGCTGCACTATATGGTCTGATTATTTGTCAGTACTTTGGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 10.80% 1.25% 53.81% NA
All Indica  2759 5.00% 11.30% 1.78% 81.99% NA
All Japonica  1512 87.40% 1.10% 0.20% 11.31% NA
Aus  269 12.60% 62.80% 1.12% 23.42% NA
Indica I  595 11.80% 4.40% 1.01% 82.86% NA
Indica II  465 2.20% 28.60% 1.94% 67.31% NA
Indica III  913 1.50% 5.30% 0.99% 92.22% NA
Indica Intermediate  786 5.50% 13.20% 3.18% 78.12% NA
Temperate Japonica  767 97.30% 1.30% 0.00% 1.43% NA
Tropical Japonica  504 71.40% 0.80% 0.40% 27.38% NA
Japonica Intermediate  241 89.60% 0.80% 0.41% 9.13% NA
VI/Aromatic  96 92.70% 3.10% 0.00% 4.17% NA
Intermediate  90 36.70% 11.10% 4.44% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117213282 A -> DEL N N silent_mutation Average:84.149; most accessible tissue: Callus, score: 93.57 N N N N
vg1117213282 A -> C LOC_Os11g29700.1 upstream_gene_variant ; 456.0bp to feature; MODIFIER silent_mutation Average:84.149; most accessible tissue: Callus, score: 93.57 N N N N
vg1117213282 A -> C LOC_Os11g29700.2 upstream_gene_variant ; 456.0bp to feature; MODIFIER silent_mutation Average:84.149; most accessible tissue: Callus, score: 93.57 N N N N
vg1117213282 A -> C LOC_Os11g29700.3 upstream_gene_variant ; 456.0bp to feature; MODIFIER silent_mutation Average:84.149; most accessible tissue: Callus, score: 93.57 N N N N
vg1117213282 A -> C LOC_Os11g29690.1 downstream_gene_variant ; 3118.0bp to feature; MODIFIER silent_mutation Average:84.149; most accessible tissue: Callus, score: 93.57 N N N N
vg1117213282 A -> C LOC_Os11g29700-LOC_Os11g29710 intergenic_region ; MODIFIER silent_mutation Average:84.149; most accessible tissue: Callus, score: 93.57 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117213282 A C 0.03 0.0 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117213282 NA 4.29E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 6.88E-12 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 6.92E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 1.31E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 5.33E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 1.43E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 8.50E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 6.69E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 6.57E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 1.29E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 3.47E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 1.44E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 1.96E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 2.44E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 1.91E-07 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117213282 NA 5.77E-11 mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251