Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117210267:

Variant ID: vg1117210267 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17210267
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CAGATTTTTCCTGCTAATGCAAGACATTTGCAAGTTAGTTATCGAGTTATTGCGTGATAGCTCAGAAGTTACCCACTGGACAGTTTTACACCTGCATTGC[A/G]
CTTCCAAAATAACGAGTTTATGCTGTTTCTAGGTTCGTTGTGTGTCGATTTGATGCTTCTTGCAACGATGTTAAACCATAAAAAGAAACAAAAATTAAAA

Reverse complement sequence

TTTTAATTTTTGTTTCTTTTTATGGTTTAACATCGTTGCAAGAAGCATCAAATCGACACACAACGAACCTAGAAACAGCATAAACTCGTTATTTTGGAAG[T/C]
GCAATGCAGGTGTAAAACTGTCCAGTGGGTAACTTCTGAGCTATCACGCAATAACTCGATAACTAACTTGCAAATGTCTTGCATTAGCAGGAAAAATCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	31.40%	0.02%	0.02%	NA
All Indica	2759	54.00%	46.00%	0.04%	0.04%	NA
All Japonica	1512	88.50%	11.50%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	75.30%	24.70%	0.00%	0.00%	NA
Indica II	465	43.70%	56.30%	0.00%	0.00%	NA
Indica III	913	45.10%	54.70%	0.11%	0.11%	NA
Indica Intermediate	786	54.20%	45.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	71.80%	28.20%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117210267	A -> DEL	N	N	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N
vg1117210267	A -> G	LOC_Os11g29680.1	downstream_gene_variant ; 4486.0bp to feature; MODIFIER	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N
vg1117210267	A -> G	LOC_Os11g29690.1	downstream_gene_variant ; 103.0bp to feature; MODIFIER	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N
vg1117210267	A -> G	LOC_Os11g29700.1	downstream_gene_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N
vg1117210267	A -> G	LOC_Os11g29700.2	downstream_gene_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N
vg1117210267	A -> G	LOC_Os11g29700.3	downstream_gene_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N
vg1117210267	A -> G	LOC_Os11g29690-LOC_Os11g29700	intergenic_region ; MODIFIER	silent_mutation	Average:64.385; most accessible tissue: Callus, score: 91.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117210267	NA	9.76E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	4.38E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	2.44E-06	mr1359	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	8.49E-07	8.49E-07	mr1359	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	1.51E-07	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	5.99E-06	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	3.84E-07	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	3.61E-06	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	6.27E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	1.78E-07	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	2.39E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	1.71E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117210267	NA	6.91E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251