\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117199869:

Variant ID: vg1117199869 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 17199869
Reference Allele: GAlternative Allele: GTATAAACTTTATATACATCGTA,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAAGTTTGTATATGTTGTGTAGTTTTTAGTTTTATTATTTTTTAATACGTATGTATATAAAGTTTATATTTATCATATACAAAGTTTGTATATGTCCT[G/GTATAAACTTTATATACATCGTA,A]
TATAAACTTTATATACATCGTATATAAACTTTGTATATATGTATATATTTTTTATGCATTAAAAATATTTATATATATACACATATACATACGTATATAC

Reverse complement sequence

GTATATACGTATGTATATGTGTATATATATAAATATTTTTAATGCATAAAAAATATATACATATATACAAAGTTTATATACGATGTATATAAAGTTTATA[C/TACGATGTATATAAAGTTTATAC,T]
AGGACATATACAAACTTTGTATATGATAAATATAAACTTTATATACATACGTATTAAAAAATAATAAAACTAAAAACTACACAACATATACAAACTTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 16.60% 3.96% 6.58% GTATAAACTTTATATACATCGTA: 2.43%
All Indica  2759 70.30% 18.60% 3.91% 5.22% GTATAAACTTTATATACATCGTA: 1.96%
All Japonica  1512 75.70% 16.30% 4.30% 0.00% GTATAAACTTTATATACATCGTA: 3.70%
Aus  269 36.10% 2.60% 1.12% 60.22% NA
Indica I  595 87.40% 1.30% 7.23% 0.17% GTATAAACTTTATATACATCGTA: 3.87%
Indica II  465 46.20% 37.20% 4.73% 11.83% NA
Indica III  913 73.80% 18.90% 0.66% 4.38% GTATAAACTTTATATACATCGTA: 2.19%
Indica Intermediate  786 67.40% 20.40% 4.71% 6.11% GTATAAACTTTATATACATCGTA: 1.40%
Temperate Japonica  767 97.40% 1.00% 1.17% 0.00% GTATAAACTTTATATACATCGTA: 0.39%
Tropical Japonica  504 39.50% 42.50% 8.73% 0.00% GTATAAACTTTATATACATCGTA: 9.33%
Japonica Intermediate  241 82.20% 10.40% 4.98% 0.00% GTATAAACTTTATATACATCGTA: 2.49%
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 63.30% 17.80% 11.11% 2.22% GTATAAACTTTATATACATCGTA: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117199869 G -> GTATAAACTTTATATACATCGTA LOC_Os11g29680.1 upstream_gene_variant ; 3219.0bp to feature; MODIFIER silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N
vg1117199869 G -> GTATAAACTTTATATACATCGTA LOC_Os11g29670.1 downstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N
vg1117199869 G -> GTATAAACTTTATATACATCGTA LOC_Os11g29660-LOC_Os11g29670 intergenic_region ; MODIFIER silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N
vg1117199869 G -> A LOC_Os11g29680.1 upstream_gene_variant ; 3220.0bp to feature; MODIFIER silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N
vg1117199869 G -> A LOC_Os11g29670.1 downstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N
vg1117199869 G -> A LOC_Os11g29660-LOC_Os11g29670 intergenic_region ; MODIFIER silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N
vg1117199869 G -> DEL N N silent_mutation Average:82.163; most accessible tissue: Minghui63 root, score: 92.93 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117199869 G A 0.0 0.01 0.0 -0.01 0.0 0.0
vg1117199869 G GTATA* 0.04 0.16 0.15 0.15 0.14 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117199869 NA 2.06E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 1.75E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 3.38E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 2.40E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 5.73E-08 mr1609 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 1.26E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 9.28E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 2.62E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 4.41E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 5.47E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 1.92E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 3.27E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 6.60E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117199869 NA 5.46E-06 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251