Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117181891:

Variant ID: vg1117181891 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17181891
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTCAATCAAAATTTGTTAAAATTTTGAATAATTTCGTAAAAAAGTAACAAAATTCACGAAATTTCGATCTTCTGTTAAAAAATAATTTTGCAAAAAA[G/A]
TACCGATATTAACGAAATTTCAGTTTTTTTCTGAAAGTGTCAACCCTCGTGTTCCAAAGAAGACCATGTATATGTAGAACAATTGGAGTAATTCTTACAA

Reverse complement sequence

TTGTAAGAATTACTCCAATTGTTCTACATATACATGGTCTTCTTTGGAACACGAGGGTTGACACTTTCAGAAAAAAACTGAAATTTCGTTAATATCGGTA[C/T]
TTTTTTGCAAAATTATTTTTTAACAGAAGATCGAAATTTCGTGAATTTTGTTACTTTTTTACGAAATTATTCAAAATTTTAACAAATTTTGATTGAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	22.40%	0.51%	17.08%	NA
All Indica	2759	43.50%	33.00%	0.51%	23.05%	NA
All Japonica	1512	91.70%	7.40%	0.13%	0.79%	NA
Aus	269	41.30%	1.90%	2.23%	54.65%	NA
Indica I	595	71.30%	27.20%	0.50%	1.01%	NA
Indica II	465	19.60%	32.50%	0.86%	47.10%	NA
Indica III	913	37.60%	38.80%	0.11%	23.55%	NA
Indica Intermediate	786	43.40%	30.90%	0.76%	24.94%	NA
Temperate Japonica	767	97.30%	2.00%	0.00%	0.78%	NA
Tropical Japonica	504	83.10%	15.50%	0.40%	0.99%	NA
Japonica Intermediate	241	91.70%	7.90%	0.00%	0.41%	NA
VI/Aromatic	96	94.80%	2.10%	0.00%	3.12%	NA
Intermediate	90	55.60%	32.20%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117181891	G -> A	LOC_Os11g29620.1	upstream_gene_variant ; 1957.0bp to feature; MODIFIER	silent_mutation	Average:45.945; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg1117181891	G -> A	LOC_Os11g29640.1	downstream_gene_variant ; 2491.0bp to feature; MODIFIER	silent_mutation	Average:45.945; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg1117181891	G -> A	LOC_Os11g29650.1	downstream_gene_variant ; 3601.0bp to feature; MODIFIER	silent_mutation	Average:45.945; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg1117181891	G -> A	LOC_Os11g29630.1	intron_variant ; MODIFIER	silent_mutation	Average:45.945; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg1117181891	G -> DEL	N	N	silent_mutation	Average:45.945; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117181891	NA	3.21E-14	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	1.99E-09	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	8.36E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	1.77E-07	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	1.28E-09	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	1.66E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	4.83E-06	4.84E-06	mr1391	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	2.17E-06	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	7.87E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	4.90E-06	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	2.61E-09	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	7.05E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	5.86E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	3.76E-08	mr1875	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	2.01E-07	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	4.82E-08	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	4.54E-06	mr1937	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	7.63E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891	NA	7.36E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251