\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117181891:

Variant ID: vg1117181891 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17181891
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCAATCAAAATTTGTTAAAATTTTGAATAATTTCGTAAAAAAGTAACAAAATTCACGAAATTTCGATCTTCTGTTAAAAAATAATTTTGCAAAAAA[G/A]
TACCGATATTAACGAAATTTCAGTTTTTTTCTGAAAGTGTCAACCCTCGTGTTCCAAAGAAGACCATGTATATGTAGAACAATTGGAGTAATTCTTACAA

Reverse complement sequence

TTGTAAGAATTACTCCAATTGTTCTACATATACATGGTCTTCTTTGGAACACGAGGGTTGACACTTTCAGAAAAAAACTGAAATTTCGTTAATATCGGTA[C/T]
TTTTTTGCAAAATTATTTTTTAACAGAAGATCGAAATTTCGTGAATTTTGTTACTTTTTTACGAAATTATTCAAAATTTTAACAAATTTTGATTGAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 22.40% 0.51% 17.08% NA
All Indica  2759 43.50% 33.00% 0.51% 23.05% NA
All Japonica  1512 91.70% 7.40% 0.13% 0.79% NA
Aus  269 41.30% 1.90% 2.23% 54.65% NA
Indica I  595 71.30% 27.20% 0.50% 1.01% NA
Indica II  465 19.60% 32.50% 0.86% 47.10% NA
Indica III  913 37.60% 38.80% 0.11% 23.55% NA
Indica Intermediate  786 43.40% 30.90% 0.76% 24.94% NA
Temperate Japonica  767 97.30% 2.00% 0.00% 0.78% NA
Tropical Japonica  504 83.10% 15.50% 0.40% 0.99% NA
Japonica Intermediate  241 91.70% 7.90% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 2.10% 0.00% 3.12% NA
Intermediate  90 55.60% 32.20% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117181891 G -> A LOC_Os11g29620.1 upstream_gene_variant ; 1957.0bp to feature; MODIFIER silent_mutation Average:45.945; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1117181891 G -> A LOC_Os11g29640.1 downstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:45.945; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1117181891 G -> A LOC_Os11g29650.1 downstream_gene_variant ; 3601.0bp to feature; MODIFIER silent_mutation Average:45.945; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1117181891 G -> A LOC_Os11g29630.1 intron_variant ; MODIFIER silent_mutation Average:45.945; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1117181891 G -> DEL N N silent_mutation Average:45.945; most accessible tissue: Minghui63 root, score: 77.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117181891 NA 3.21E-14 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 1.99E-09 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 8.36E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 1.77E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 1.28E-09 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 1.66E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 4.83E-06 4.84E-06 mr1391 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 2.17E-06 mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 7.87E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 4.90E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 2.61E-09 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 7.05E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 5.86E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 3.76E-08 mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 2.01E-07 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 4.82E-08 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 4.54E-06 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 7.63E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117181891 NA 7.36E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251