\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117180570:

Variant ID: vg1117180570 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17180570
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCACGACGTACCAAAGCGCATGGCAAAAACATCTTTAATTTTATAATAGTAAAGATAGAGATAGAGATAAGTTTCGGCTTCTTTATCCCTCGTTTAAA[T/A]
TATTTACACATAGTATAAATGAAGCACATACATGAAACAAAACCTAAAATGTTTTTATAATTTGAAACGGAACAAAGTAATTTAGCTCTGCATATCGTTT

Reverse complement sequence

AAACGATATGCAGAGCTAAATTACTTTGTTCCGTTTCAAATTATAAAAACATTTTAGGTTTTGTTTCATGTATGTGCTTCATTTATACTATGTGTAAATA[A/T]
TTTAAACGAGGGATAAAGAAGCCGAAACTTATCTCTATCTCTATCTTTACTATTATAAAATTAAAGATGTTTTTGCCATGCGCTTTGGTACGTCGTGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.10% 0.34% 0.00% NA
All Indica  2759 67.40% 32.10% 0.51% 0.00% NA
All Japonica  1512 88.50% 11.40% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 72.80% 27.20% 0.00% 0.00% NA
Indica II  465 68.80% 30.80% 0.43% 0.00% NA
Indica III  913 61.90% 37.60% 0.55% 0.00% NA
Indica Intermediate  786 69.00% 30.20% 0.89% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 72.60% 27.20% 0.20% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117180570 T -> A LOC_Os11g29630.1 3_prime_UTR_variant ; 100.0bp to feature; MODIFIER silent_mutation Average:69.061; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1117180570 T -> A LOC_Os11g29620.1 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:69.061; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1117180570 T -> A LOC_Os11g29640.1 downstream_gene_variant ; 3812.0bp to feature; MODIFIER silent_mutation Average:69.061; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1117180570 T -> A LOC_Os11g29650.1 downstream_gene_variant ; 4922.0bp to feature; MODIFIER silent_mutation Average:69.061; most accessible tissue: Minghui63 root, score: 94.42 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117180570 T A -0.01 -0.04 -0.04 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117180570 NA 6.45E-09 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 6.14E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 2.52E-06 5.08E-10 mr1380 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 9.72E-06 4.80E-07 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 1.97E-06 mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 8.86E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 2.87E-09 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 1.34E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 4.55E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 6.36E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 2.13E-07 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 4.12E-07 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 3.04E-08 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 2.89E-06 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117180570 NA 9.51E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251