Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117176992:

Variant ID: vg1117176992 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17176992
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, G: 0.09, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTGTCGCCGTTCTGCTGCCGCTAGACTGACACCAATGGCAAACTCCACTGAGGATTTGCCAACTGGGGAGGAGTAGGACGCCATGAATCCGATCCCAC[C/G]
TCTGGCCAATCAGGGTCGCCGACCATGTGCAGCAGGACATGGAAGATCCTCCGCTCGTCGCCGACGAGCTGAGGTGGTCCGGCGCGGCAGCGCGCGCTCA

Reverse complement sequence

TGAGCGCGCGCTGCCGCGCCGGACCACCTCAGCTCGTCGGCGACGAGCGGAGGATCTTCCATGTCCTGCTGCACATGGTCGGCGACCCTGATTGGCCAGA[G/C]
GTGGGATCGGATTCATGGCGTCCTACTCCTCCCCAGTTGGCAAATCCTCAGTGGAGTTTGCCATTGGTGTCAGTCTAGCGGCAGCAGAACGGCGACACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	26.60%	0.76%	17.65%	NA
All Indica	2759	33.40%	42.10%	0.98%	23.49%	NA
All Japonica	1512	98.10%	1.10%	0.00%	0.79%	NA
Aus	269	16.00%	21.20%	2.60%	60.22%	NA
Indica I	595	34.10%	64.70%	0.00%	1.18%	NA
Indica II	465	19.40%	28.40%	1.51%	50.75%	NA
Indica III	913	40.10%	36.70%	1.10%	22.12%	NA
Indica Intermediate	786	33.50%	39.40%	1.27%	25.83%	NA
Temperate Japonica	767	97.90%	1.30%	0.00%	0.78%	NA
Tropical Japonica	504	98.20%	0.80%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	94.80%	2.10%	1.04%	2.08%	NA
Intermediate	90	64.40%	23.30%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117176992	C -> DEL	N	N	silent_mutation	Average:82.2; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N
vg1117176992	C -> G	LOC_Os11g29610.1	downstream_gene_variant ; 1802.0bp to feature; MODIFIER	silent_mutation	Average:82.2; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N
vg1117176992	C -> G	LOC_Os11g29620.1	downstream_gene_variant ; 2358.0bp to feature; MODIFIER	silent_mutation	Average:82.2; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N
vg1117176992	C -> G	LOC_Os11g29630.1	downstream_gene_variant ; 3537.0bp to feature; MODIFIER	silent_mutation	Average:82.2; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N
vg1117176992	C -> G	LOC_Os11g29610-LOC_Os11g29620	intergenic_region ; MODIFIER	silent_mutation	Average:82.2; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1117176992	C	G	0.0	0.0	0.0	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117176992	NA	2.79E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	2.21E-08	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	3.58E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	2.54E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	9.32E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	1.21E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	1.88E-08	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	4.85E-06	4.84E-06	mr1832	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	1.22E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	2.68E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	1.27E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117176992	NA	7.30E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251