Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117166999:

Variant ID: vg1117166999 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17166999
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGGTCTTATGGCTTATCCTCCAACACCCCCAACCTCAAATCCCGGCTTCGCCACTGGCTGTAGTGCCTCCTGCACGGCGCCAGATCAGCGACGGGACA[T/C]
GGCAGGCATTCACTGGTTGTCGAGGTGACCGTGGCGCAGAACGGCAGCAACAATTATTGGACGATTGTTGTTGCCTTGGCCGCAGCGCCCAAGAGCAAGA

Reverse complement sequence

TCTTGCTCTTGGGCGCTGCGGCCAAGGCAACAACAATCGTCCAATAATTGTTGCTGCCGTTCTGCGCCACGGTCACCTCGACAACCAGTGAATGCCTGCC[A/G]
TGTCCCGTCGCTGATCTGGCGCCGTGCAGGAGGCACTACAGCCAGTGGCGAAGCCGGGATTTGAGGTTGGGGGTGTTGGAGGATAAGCCATAAGACCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	47.60%	0.17%	0.00%	NA
All Indica	2759	29.30%	70.60%	0.11%	0.00%	NA
All Japonica	1512	87.40%	12.30%	0.26%	0.00%	NA
Aus	269	77.00%	23.00%	0.00%	0.00%	NA
Indica I	595	11.10%	88.70%	0.17%	0.00%	NA
Indica II	465	55.10%	44.90%	0.00%	0.00%	NA
Indica III	913	24.20%	75.70%	0.11%	0.00%	NA
Indica Intermediate	786	33.70%	66.20%	0.13%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	70.40%	29.00%	0.60%	0.00%	NA
Japonica Intermediate	241	89.60%	10.00%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117166999	T -> C	LOC_Os11g29580.1	upstream_gene_variant ; 4007.0bp to feature; MODIFIER	silent_mutation	Average:65.393; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1117166999	T -> C	LOC_Os11g29610.1	upstream_gene_variant ; 3935.0bp to feature; MODIFIER	silent_mutation	Average:65.393; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1117166999	T -> C	LOC_Os11g29600.1	downstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:65.393; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg1117166999	T -> C	LOC_Os11g29580-LOC_Os11g29600	intergenic_region ; MODIFIER	silent_mutation	Average:65.393; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117166999	NA	9.55E-06	mr1064_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251