\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117163217:

Variant ID: vg1117163217 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 17163217
Reference Allele: CGGTAlternative Allele: TGGT,AGGT,C
Primary Allele: CGGTSecondary Allele: TGGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCGCCGCCACAGTCATCGTCATCACAGCGGCGTGTTCCACGCCGTTCTCGTCTCAGTGCAGCCGCTGCCGGCTGCCCTCGTCGCCTCCTCGCCGGCCC[CGGT/TGGT,AGGT,C]
CGTCGTCGTCGTCGTCCTCTCGTCGTTCCCGGTCGTCGTGGTGTTCGTCCCTCCGTCAAGCCGATCGCGTTCGCCGCCCGCGTTTCGTCAAGTGTGCAGC

Reverse complement sequence

GCTGCACACTTGACGAAACGCGGGCGGCGAACGCGATCGGCTTGACGGAGGGACGAACACCACGACGACCGGGAACGACGAGAGGACGACGACGACGACG[ACCG/ACCA,ACCT,G]
GGGCCGGCGAGGAGGCGACGAGGGCAGCCGGCAGCGGCTGCACTGAGACGAGAACGGCGTGGAACACGCCGCTGTGATGACGATGACTGTGGCGGCGCAG

Allele Frequencies:

Populations Population SizeFrequency of CGGT(primary allele) Frequency of TGGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 12.20% 4.49% 13.92% AGGT: 0.55%; C: 0.02%
All Indica  2759 71.80% 20.40% 3.44% 3.52% AGGT: 0.83%; C: 0.04%
All Japonica  1512 66.00% 0.30% 4.56% 29.03% AGGT: 0.13%
Aus  269 66.50% 0.00% 11.15% 21.93% AGGT: 0.37%
Indica I  595 89.10% 5.50% 2.86% 2.52% NA
Indica II  465 64.10% 17.00% 5.59% 10.11% AGGT: 3.23%
Indica III  913 64.50% 31.90% 1.64% 1.42% AGGT: 0.44%; C: 0.11%
Indica Intermediate  786 71.80% 20.20% 4.71% 2.80% AGGT: 0.51%
Temperate Japonica  767 88.50% 0.00% 2.09% 9.39% NA
Tropical Japonica  504 42.50% 0.80% 7.74% 48.61% AGGT: 0.40%
Japonica Intermediate  241 43.60% 0.00% 5.81% 50.62% NA
VI/Aromatic  96 28.10% 0.00% 13.54% 58.33% NA
Intermediate  90 73.30% 13.30% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117163217 CGGT -> AGGT LOC_Os11g29570.1 upstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> AGGT LOC_Os11g29580.1 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> AGGT LOC_Os11g29580-LOC_Os11g29600 intergenic_region ; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> TGGT LOC_Os11g29570.1 upstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> TGGT LOC_Os11g29580.1 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> TGGT LOC_Os11g29580-LOC_Os11g29600 intergenic_region ; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> DEL N N silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> C LOC_Os11g29570.1 upstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> C LOC_Os11g29580.1 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1117163217 CGGT -> C LOC_Os11g29580-LOC_Os11g29600 intergenic_region ; MODIFIER silent_mutation Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117163217 NA 9.84E-07 mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117163217 1.05E-06 1.05E-06 mr1869 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117163217 2.87E-07 2.87E-07 mr1869 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251