\
| Variant ID: vg1117163217 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 17163217 |
| Reference Allele: CGGT | Alternative Allele: TGGT,AGGT,C |
| Primary Allele: CGGT | Secondary Allele: TGGT |
Inferred Ancestral Allele: Not determined.
CTGCGCCGCCACAGTCATCGTCATCACAGCGGCGTGTTCCACGCCGTTCTCGTCTCAGTGCAGCCGCTGCCGGCTGCCCTCGTCGCCTCCTCGCCGGCCC[CGGT/TGGT,AGGT,C]
CGTCGTCGTCGTCGTCCTCTCGTCGTTCCCGGTCGTCGTGGTGTTCGTCCCTCCGTCAAGCCGATCGCGTTCGCCGCCCGCGTTTCGTCAAGTGTGCAGC
GCTGCACACTTGACGAAACGCGGGCGGCGAACGCGATCGGCTTGACGGAGGGACGAACACCACGACGACCGGGAACGACGAGAGGACGACGACGACGACG[ACCG/ACCA,ACCT,G]
GGGCCGGCGAGGAGGCGACGAGGGCAGCCGGCAGCGGCTGCACTGAGACGAGAACGGCGTGGAACACGCCGCTGTGATGACGATGACTGTGGCGGCGCAG
| Populations | Population Size | Frequency of CGGT(primary allele) | Frequency of TGGT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.80% | 12.20% | 4.49% | 13.92% | AGGT: 0.55%; C: 0.02% |
| All Indica | 2759 | 71.80% | 20.40% | 3.44% | 3.52% | AGGT: 0.83%; C: 0.04% |
| All Japonica | 1512 | 66.00% | 0.30% | 4.56% | 29.03% | AGGT: 0.13% |
| Aus | 269 | 66.50% | 0.00% | 11.15% | 21.93% | AGGT: 0.37% |
| Indica I | 595 | 89.10% | 5.50% | 2.86% | 2.52% | NA |
| Indica II | 465 | 64.10% | 17.00% | 5.59% | 10.11% | AGGT: 3.23% |
| Indica III | 913 | 64.50% | 31.90% | 1.64% | 1.42% | AGGT: 0.44%; C: 0.11% |
| Indica Intermediate | 786 | 71.80% | 20.20% | 4.71% | 2.80% | AGGT: 0.51% |
| Temperate Japonica | 767 | 88.50% | 0.00% | 2.09% | 9.39% | NA |
| Tropical Japonica | 504 | 42.50% | 0.80% | 7.74% | 48.61% | AGGT: 0.40% |
| Japonica Intermediate | 241 | 43.60% | 0.00% | 5.81% | 50.62% | NA |
| VI/Aromatic | 96 | 28.10% | 0.00% | 13.54% | 58.33% | NA |
| Intermediate | 90 | 73.30% | 13.30% | 5.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117163217 | CGGT -> AGGT | LOC_Os11g29570.1 | upstream_gene_variant ; 4536.0bp to feature; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> AGGT | LOC_Os11g29580.1 | upstream_gene_variant ; 225.0bp to feature; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> AGGT | LOC_Os11g29580-LOC_Os11g29600 | intergenic_region ; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> TGGT | LOC_Os11g29570.1 | upstream_gene_variant ; 4536.0bp to feature; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> TGGT | LOC_Os11g29580.1 | upstream_gene_variant ; 225.0bp to feature; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> TGGT | LOC_Os11g29580-LOC_Os11g29600 | intergenic_region ; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> DEL | N | N | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> C | LOC_Os11g29570.1 | upstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> C | LOC_Os11g29580.1 | upstream_gene_variant ; 226.0bp to feature; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg1117163217 | CGGT -> C | LOC_Os11g29580-LOC_Os11g29600 | intergenic_region ; MODIFIER | silent_mutation | Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117163217 | NA | 9.84E-07 | mr1428 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117163217 | 1.05E-06 | 1.05E-06 | mr1869 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117163217 | 2.87E-07 | 2.87E-07 | mr1869 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |