Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117163217:

Variant ID: vg1117163217 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 17163217
Reference Allele: CGGT	Alternative Allele: TGGT,AGGT,C
Primary Allele: CGGT	Secondary Allele: TGGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGCGCCGCCACAGTCATCGTCATCACAGCGGCGTGTTCCACGCCGTTCTCGTCTCAGTGCAGCCGCTGCCGGCTGCCCTCGTCGCCTCCTCGCCGGCCC[CGGT/TGGT,AGGT,C]
CGTCGTCGTCGTCGTCCTCTCGTCGTTCCCGGTCGTCGTGGTGTTCGTCCCTCCGTCAAGCCGATCGCGTTCGCCGCCCGCGTTTCGTCAAGTGTGCAGC

Reverse complement sequence

GCTGCACACTTGACGAAACGCGGGCGGCGAACGCGATCGGCTTGACGGAGGGACGAACACCACGACGACCGGGAACGACGAGAGGACGACGACGACGACG[ACCG/ACCA,ACCT,G]
GGGCCGGCGAGGAGGCGACGAGGGCAGCCGGCAGCGGCTGCACTGAGACGAGAACGGCGTGGAACACGCCGCTGTGATGACGATGACTGTGGCGGCGCAG

Allele Frequencies:

Populations	Population Size	Frequency of CGGT(primary allele)	Frequency of TGGT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	12.20%	4.49%	13.92%	AGGT: 0.55%; C: 0.02%
All Indica	2759	71.80%	20.40%	3.44%	3.52%	AGGT: 0.83%; C: 0.04%
All Japonica	1512	66.00%	0.30%	4.56%	29.03%	AGGT: 0.13%
Aus	269	66.50%	0.00%	11.15%	21.93%	AGGT: 0.37%
Indica I	595	89.10%	5.50%	2.86%	2.52%	NA
Indica II	465	64.10%	17.00%	5.59%	10.11%	AGGT: 3.23%
Indica III	913	64.50%	31.90%	1.64%	1.42%	AGGT: 0.44%; C: 0.11%
Indica Intermediate	786	71.80%	20.20%	4.71%	2.80%	AGGT: 0.51%
Temperate Japonica	767	88.50%	0.00%	2.09%	9.39%	NA
Tropical Japonica	504	42.50%	0.80%	7.74%	48.61%	AGGT: 0.40%
Japonica Intermediate	241	43.60%	0.00%	5.81%	50.62%	NA
VI/Aromatic	96	28.10%	0.00%	13.54%	58.33%	NA
Intermediate	90	73.30%	13.30%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117163217	CGGT -> AGGT	LOC_Os11g29570.1	upstream_gene_variant ; 4536.0bp to feature; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> AGGT	LOC_Os11g29580.1	upstream_gene_variant ; 225.0bp to feature; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> AGGT	LOC_Os11g29580-LOC_Os11g29600	intergenic_region ; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> TGGT	LOC_Os11g29570.1	upstream_gene_variant ; 4536.0bp to feature; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> TGGT	LOC_Os11g29580.1	upstream_gene_variant ; 225.0bp to feature; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> TGGT	LOC_Os11g29580-LOC_Os11g29600	intergenic_region ; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> DEL	N	N	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> C	LOC_Os11g29570.1	upstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> C	LOC_Os11g29580.1	upstream_gene_variant ; 226.0bp to feature; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg1117163217	CGGT -> C	LOC_Os11g29580-LOC_Os11g29600	intergenic_region ; MODIFIER	silent_mutation	Average:66.389; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117163217	NA	9.84E-07	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117163217	1.05E-06	1.05E-06	mr1869	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117163217	2.87E-07	2.87E-07	mr1869	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251