Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117161706:

Variant ID: vg1117161706 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17161706
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCCGCATCCACCCTCCTCGCCAGCGCCGGCGCCACCGCAACTGTCACGTCCTGATAAATTCATCCTGAATTAAAAATCATTCTCTAAAAGGAATAATA[G/T]
AATTAATTAAAATTCGAAAAGAAATTGGCAAACACTAAAATACGTACTAGAAAAATTCGAATGTTGTCCGGAGATTTTTTGTTAAATTCTCCATGGTCTA

Reverse complement sequence

TAGACCATGGAGAATTTAACAAAAAATCTCCGGACAACATTCGAATTTTTCTAGTACGTATTTTAGTGTTTGCCAATTTCTTTTCGAATTTTAATTAATT[C/A]
TATTATTCCTTTTAGAGAATGATTTTTAATTCAGGATGAATTTATCAGGACGTGACAGTTGCGGTGGCGCCGGCGCTGGCGAGGAGGGTGGATGCGGCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	11.00%	6.47%	16.53%	NA
All Indica	2759	70.20%	18.40%	7.21%	4.17%	NA
All Japonica	1512	61.40%	0.30%	2.18%	36.11%	NA
Aus	269	65.80%	0.00%	21.93%	12.27%	NA
Indica I	595	88.70%	5.50%	1.85%	3.87%	NA
Indica II	465	68.80%	14.20%	11.40%	5.59%	NA
Indica III	913	58.70%	30.40%	7.34%	3.50%	NA
Indica Intermediate	786	70.40%	16.70%	8.65%	4.33%	NA
Temperate Japonica	767	87.90%	0.10%	0.91%	11.08%	NA
Tropical Japonica	504	35.30%	0.60%	4.37%	59.72%	NA
Japonica Intermediate	241	32.00%	0.00%	1.66%	66.39%	NA
VI/Aromatic	96	11.50%	2.10%	8.33%	78.12%	NA
Intermediate	90	71.10%	7.80%	7.78%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117161706	G -> T	LOC_Os11g29570.1	upstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:28.968; most accessible tissue: Callus, score: 49.336	N	N	N	N
vg1117161706	G -> T	LOC_Os11g29580.1	downstream_gene_variant ; 1038.0bp to feature; MODIFIER	silent_mutation	Average:28.968; most accessible tissue: Callus, score: 49.336	N	N	N	N
vg1117161706	G -> T	LOC_Os11g29570-LOC_Os11g29580	intergenic_region ; MODIFIER	silent_mutation	Average:28.968; most accessible tissue: Callus, score: 49.336	N	N	N	N
vg1117161706	G -> DEL	N	N	silent_mutation	Average:28.968; most accessible tissue: Callus, score: 49.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117161706	NA	4.73E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	3.41E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	2.22E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	5.14E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	6.74E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	2.39E-06	mr1115	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	3.50E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	6.08E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	7.28E-06	7.28E-06	mr1230	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	5.83E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	4.60E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	4.34E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	8.23E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	2.94E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	5.81E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	8.22E-07	8.23E-07	mr1391	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	6.84E-07	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	1.31E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	4.63E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	6.57E-06	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	2.96E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	8.74E-06	mr1635	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	8.83E-06	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	2.15E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	6.23E-07	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	7.02E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	2.69E-06	2.71E-06	mr1869	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	6.30E-07	6.30E-07	mr1869	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117161706	NA	2.61E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251