\
| Variant ID: vg1117158706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17158706 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAAGTCGAAGCTGCCGAATCGGAACGCCTGCCCGGGAGGGAAGGCGAAGTCGTCGATGCCAGAAACGAAACCCATCGTACTTAGTCGGCGAGAACTTGA[C/T]
GCCTCCCCTACCTGGCGAGCCAACTATCGAAACAAGATTTCGGCAATAATAAAAGGGGGTGGCTATCAAGCTAGGAAAGTGGATGGGTTTGGAGACAATG
CATTGTCTCCAAACCCATCCACTTTCCTAGCTTGATAGCCACCCCCTTTTATTATTGCCGAAATCTTGTTTCGATAGTTGGCTCGCCAGGTAGGGGAGGC[G/A]
TCAAGTTCTCGCCGACTAAGTACGATGGGTTTCGTTTCTGGCATCGACGACTTCGCCTTCCCTCCCGGGCAGGCGTTCCGATTCGGCAGCTTCGACTTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 0.60% | 1.52% | 8.15% | NA |
| All Indica | 2759 | 99.10% | 0.40% | 0.33% | 0.18% | NA |
| All Japonica | 1512 | 72.90% | 0.90% | 3.90% | 22.22% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.30% | 0.67% | 0.67% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 92.00% | 0.40% | 0.39% | 7.17% | NA |
| Tropical Japonica | 504 | 54.00% | 2.20% | 9.92% | 33.93% | NA |
| Japonica Intermediate | 241 | 51.90% | 0.00% | 2.49% | 45.64% | NA |
| VI/Aromatic | 96 | 53.10% | 0.00% | 2.08% | 44.79% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117158706 | C -> T | LOC_Os11g29570.1 | upstream_gene_variant ; 25.0bp to feature; MODIFIER | silent_mutation | Average:26.337; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1117158706 | C -> T | LOC_Os11g29580.1 | downstream_gene_variant ; 4038.0bp to feature; MODIFIER | silent_mutation | Average:26.337; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1117158706 | C -> T | LOC_Os11g29570-LOC_Os11g29580 | intergenic_region ; MODIFIER | silent_mutation | Average:26.337; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1117158706 | C -> DEL | N | N | silent_mutation | Average:26.337; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117158706 | NA | 9.99E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117158706 | NA | 9.99E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117158706 | NA | 7.67E-07 | mr1921 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |