\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117156319:

Variant ID: vg1117156319 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17156319
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATTACTCGGCTTTAATTCCGTGCGAGGAATCTGCATATCGTCCAGGGTCTTAGCGAAAAGGATGTTGAGTGCGCTGCCACCATCGATGAGAGTCCGT[T/C]
GGAGCTTGACATTGCGAACCACTAGGTCTAGTACCAGGGGGTACCGCCCCGGGTGGACCACTCGGTCGGGATGATCCGAGCAGTCGAACTTAATTGCTGT

Reverse complement sequence

ACAGCAATTAAGTTCGACTGCTCGGATCATCCCGACCGAGTGGTCCACCCGGGGCGGTACCCCCTGGTACTAGACCTAGTGGTTCGCAATGTCAAGCTCC[A/G]
ACGGACTCTCATCGATGGTGGCAGCGCACTCAACATCCTTTTCGCTAAGACCCTGGACGATATGCAGATTCCTCGCACGGAATTAAAGCCGAGTAATGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 3.40% 28.16% 34.38% NA
All Indica  2759 29.00% 5.00% 39.18% 26.82% NA
All Japonica  1512 48.90% 1.10% 10.52% 39.55% NA
Aus  269 12.60% 0.40% 21.93% 65.06% NA
Indica I  595 19.70% 3.50% 58.32% 18.49% NA
Indica II  465 33.50% 14.60% 12.47% 39.35% NA
Indica III  913 33.10% 0.90% 41.62% 24.42% NA
Indica Intermediate  786 28.80% 5.10% 37.66% 28.50% NA
Temperate Japonica  767 85.80% 1.30% 0.91% 11.99% NA
Tropical Japonica  504 6.50% 0.80% 25.60% 67.06% NA
Japonica Intermediate  241 19.90% 0.80% 9.54% 69.71% NA
VI/Aromatic  96 4.20% 0.00% 5.21% 90.62% NA
Intermediate  90 32.20% 10.00% 30.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117156319 T -> DEL LOC_Os11g29570.1 N frameshift_variant Average:17.259; most accessible tissue: Callus, score: 27.653 N N N N
vg1117156319 T -> C LOC_Os11g29570.1 missense_variant ; p.Gln650Arg; MODERATE nonsynonymous_codon ; Q650R Average:17.259; most accessible tissue: Callus, score: 27.653 benign -0.385 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117156319 NA 2.20E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 8.15E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 9.98E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 4.00E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.75E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.96E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.28E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 5.11E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 7.19E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.59E-06 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 4.39E-06 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 2.83E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.77E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 6.43E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.95E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 2.12E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.40E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 2.49E-07 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.01E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 1.15E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 5.15E-08 5.12E-08 mr1869 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 4.89E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117156319 NA 7.33E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251