Search for Variation information by Variation ID:
Detailed information for vg1117151229:
| Variant ID: vg1117151229 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17151229 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )
Flanking Sequence (100 bp) in Reference Genome:
AGCCGAAGCCGGGGTTAATCAGGAGCCCCCGACTGAAAACCAGTCGGACGCAGGGCCAAGCCAAGAGATTCCAGAAGTTAGAGCTCAAGCAGACAGCCTT[C/T]
GCGGACAAGACGCCAGCAATAACCAGAGATCTAGATCTCCTTTAAAGGCATCCGAACCCACTCGTCCTCGTCCAAAAATCATTACGGGTAAAACACTTTG
Reverse complement sequence
CAAAGTGTTTTACCCGTAATGATTTTTGGACGAGGACGAGTGGGTTCGGATGCCTTTAAAGGAGATCTAGATCTCTGGTTATTGCTGGCGTCTTGTCCGC[G/A]
AAGGCTGTCTGCTTGAGCTCTAACTTCTGGAATCTCTTGGCTTGGCCCTGCGTCCGACTGGTTTTCAGTCGGGGGCTCCTGATTAACCCCGGCTTCGGCT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 14.30% | 1.50% | 30.15% | NA |
| All Indica | 2759 | 53.20% | 23.90% | 0.58% | 22.29% | NA |
| All Japonica | 1512 | 61.40% | 0.20% | 3.31% | 35.05% | NA |
| Aus | 269 | 34.90% | 1.10% | 0.37% | 63.57% | NA |
| Indica I | 595 | 33.90% | 59.70% | 0.34% | 6.05% | NA |
| Indica II | 465 | 51.80% | 8.60% | 1.29% | 38.28% | NA |
| Indica III | 913 | 67.00% | 9.40% | 0.11% | 23.44% | NA |
| Indica Intermediate | 786 | 52.50% | 22.80% | 0.89% | 23.79% | NA |
| Temperate Japonica | 767 | 88.40% | 0.00% | 2.35% | 9.26% | NA |
| Tropical Japonica | 504 | 34.10% | 0.20% | 2.58% | 63.10% | NA |
| Japonica Intermediate | 241 | 32.80% | 0.80% | 7.88% | 58.51% | NA |
| VI/Aromatic | 96 | 7.30% | 2.10% | 2.08% | 88.54% | NA |
| Intermediate | 90 | 63.30% | 7.80% | 2.22% | 26.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117151229 | C -> T | LOC_Os11g29560.1 | missense_variant ; p.Arg222Cys; MODERATE | nonsynonymous_codon ; R222C | Average:24.01; most accessible tissue: Minghui63 young leaf, score: 38.036 | probably damaging  |
3.288 |
TOLERATED | 0.09 |
| vg1117151229 | C -> DEL | LOC_Os11g29560.1 | N | frameshift_variant | Average:24.01; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117151229 | NA | 4.47E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 2.18E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 1.80E-06 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 4.76E-07 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 3.55E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 7.45E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 9.98E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 5.18E-08 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 9.26E-06 | mr1906 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117151229 | NA | 5.46E-07 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |